Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208947655:

Variant ID: vg1208947655 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8947655
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.52, A: 0.48, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TATCTCTGTGTTTGCAAAGTGCACCAACAGCACTCCTTACAAAAATTTCGACTAAACTCGAAACCCTAACTCAAAACTCAACTCAATTGCTCTCAAAAGC[A/G]
ATACAGGGAAGCCTCACGCTCCCCCTTTATTTATACCCAAGGTAGGCAGCCTAAAGCCACGGAACAAACTCATACTAGAAGTCCTAAACACCTTAGGAAA

Reverse complement sequence

TTTCCTAAGGTGTTTAGGACTTCTAGTATGAGTTTGTTCCGTGGCTTTAGGCTGCCTACCTTGGGTATAAATAAAGGGGGAGCGTGAGGCTTCCCTGTAT[T/C]
GCTTTTGAGAGCAATTGAGTTGAGTTTTGAGTTAGGGTTTCGAGTTTAGTCGAAATTTTTGTAAGGAGTGCTGTTGGTGCACTTTGCAAACACAGAGATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.70%	36.60%	2.20%	21.52%	NA
All Indica	2759	54.00%	7.50%	3.48%	34.98%	NA
All Japonica	1512	4.40%	94.50%	0.07%	1.06%	NA
Aus	269	81.00%	7.40%	1.86%	9.67%	NA
Indica I	595	35.50%	13.60%	3.03%	47.90%	NA
Indica II	465	51.20%	6.50%	5.38%	36.99%	NA
Indica III	913	66.70%	3.60%	2.52%	27.16%	NA
Indica Intermediate	786	55.10%	8.00%	3.82%	33.08%	NA
Temperate Japonica	767	6.00%	92.80%	0.13%	1.04%	NA
Tropical Japonica	504	3.40%	95.60%	0.00%	0.99%	NA
Japonica Intermediate	241	1.20%	97.50%	0.00%	1.24%	NA
VI/Aromatic	96	71.90%	24.00%	1.04%	3.12%	NA
Intermediate	90	34.40%	56.70%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208947655	A -> DEL	N	N	silent_mutation	Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg1208947655	A -> G	LOC_Os12g15660.1	upstream_gene_variant ; 4211.0bp to feature; MODIFIER	silent_mutation	Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg1208947655	A -> G	LOC_Os12g15670.1	downstream_gene_variant ; 2432.0bp to feature; MODIFIER	silent_mutation	Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg1208947655	A -> G	LOC_Os12g15660-LOC_Os12g15670	intergenic_region ; MODIFIER	silent_mutation	Average:26.507; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208947655	NA	5.10E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655	NA	2.18E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655	NA	5.94E-25	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655	NA	9.70E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655	9.24E-07	2.59E-08	mr1889_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655	NA	2.46E-07	mr1896_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208947655	2.03E-06	1.16E-08	mr1907_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251