| Variant ID: vg1208774960 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 8774960 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCCGAAAGGGGGCGCCTCGTGGTATACCATACGACTTACACGGTCTCGGCCGAAGCTCCCTACTCACCCTTGCCCGTGAGAGGCTTGTTGGAGGTATAC[C/A]
ACGAAGGGCCTTCGGCCCGACCTGCCGAAACCGAGGACTTGAGCGACAAGCTTAGACCAGAGGCAAGCGGCGAAAATCGAGAAGGGAACCGTACAGGCGA
TCGCCTGTACGGTTCCCTTCTCGATTTTCGCCGCTTGCCTCTGGTCTAAGCTTGTCGCTCAAGTCCTCGGTTTCGGCAGGTCGGGCCGAAGGCCCTTCGT[G/T]
GTATACCTCCAACAAGCCTCTCACGGGCAAGGGTGAGTAGGGAGCTTCGGCCGAGACCGTGTAAGTCGTATGGTATACCACGAGGCGCCCCCTTTCGGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 8.60% | 19.93% | 8.99% | NA |
| All Indica | 2759 | 47.40% | 14.50% | 27.26% | 10.84% | NA |
| All Japonica | 1512 | 96.20% | 0.10% | 0.93% | 2.84% | NA |
| Aus | 269 | 21.20% | 1.10% | 52.42% | 25.28% | NA |
| Indica I | 595 | 34.30% | 8.90% | 38.32% | 18.49% | NA |
| Indica II | 465 | 46.70% | 10.80% | 28.60% | 13.98% | NA |
| Indica III | 913 | 57.20% | 21.70% | 17.85% | 3.29% | NA |
| Indica Intermediate | 786 | 46.40% | 12.60% | 29.01% | 11.96% | NA |
| Temperate Japonica | 767 | 94.80% | 0.00% | 0.91% | 4.30% | NA |
| Tropical Japonica | 504 | 97.60% | 0.20% | 0.79% | 1.39% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 66.70% | 1.00% | 18.75% | 13.54% | NA |
| Intermediate | 90 | 75.60% | 3.30% | 18.89% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1208774960 | C -> DEL | LOC_Os12g15370.1 | N | frameshift_variant | Average:28.584; most accessible tissue: Callus, score: 66.444 | N | N | N | N |
| vg1208774960 | C -> A | LOC_Os12g15370.1 | missense_variant ; p.Trp41Leu; MODERATE | nonsynonymous_codon ; W41L | Average:28.584; most accessible tissue: Callus, score: 66.444 | unknown | unknown | TOLERATED | 0.09 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1208774960 | NA | 5.88E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774960 | 3.28E-06 | NA | mr1376 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774960 | 3.28E-06 | NA | mr1431 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774960 | NA | 8.60E-06 | mr1731 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1208774960 | 6.16E-06 | 6.16E-06 | mr1869 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |