Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208420591:

Variant ID: vg1208420591 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8420591
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.82, T: 0.18, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CTCACCTCTCTCACTTCCCTCATCTCTCTATACAAGCAGTCCGCCATGATAAACATCATAAACCAGTGCTAAGTGCAGCAATGGTATACATACCTCTGAT[C/T]
ATATTCCTCTTCTCATACCACAAATTGGCTTCTTCAACAAAGTGGACAGACTAAATTTCAATATCCTGCTGAGTGCTGAATATGGGAGAACAAATCTTTT

Reverse complement sequence

AAAAGATTTGTTCTCCCATATTCAGCACTCAGCAGGATATTGAAATTTAGTCTGTCCACTTTGTTGAAGAAGCCAATTTGTGGTATGAGAAGAGGAATAT[G/A]
ATCAGAGGTATGTATACCATTGCTGCACTTAGCACTGGTTTATGATGTTTATCATGGCGGACTGCTTGTATAGAGAGATGAGGGAAGTGAGAGAGGTGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.10%	26.60%	0.44%	24.88%	NA
All Indica	2759	24.10%	44.00%	0.62%	31.24%	NA
All Japonica	1512	95.80%	1.20%	0.07%	2.91%	NA
Aus	269	22.30%	2.20%	0.74%	74.72%	NA
Indica I	595	43.20%	28.10%	0.67%	28.07%	NA
Indica II	465	21.90%	39.80%	0.65%	37.63%	NA
Indica III	913	12.60%	57.60%	0.11%	29.68%	NA
Indica Intermediate	786	24.30%	42.90%	1.15%	31.68%	NA
Temperate Japonica	767	94.70%	0.50%	0.13%	4.69%	NA
Tropical Japonica	504	96.40%	2.60%	0.00%	0.99%	NA
Japonica Intermediate	241	98.30%	0.40%	0.00%	1.24%	NA
VI/Aromatic	96	37.50%	2.10%	1.04%	59.38%	NA
Intermediate	90	70.00%	16.70%	0.00%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208420591	C -> DEL	N	N	silent_mutation	Average:39.395; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1208420591	C -> T	LOC_Os12g14699.1	upstream_gene_variant ; 2937.0bp to feature; MODIFIER	silent_mutation	Average:39.395; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1208420591	C -> T	LOC_Os12g14720.1	upstream_gene_variant ; 3652.0bp to feature; MODIFIER	silent_mutation	Average:39.395; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1208420591	C -> T	LOC_Os12g14699-LOC_Os12g14720	intergenic_region ; MODIFIER	silent_mutation	Average:39.395; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208420591	NA	6.26E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208420591	NA	4.10E-07	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208420591	NA	8.39E-11	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208420591	NA	2.47E-08	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208420591	NA	5.31E-06	mr1436	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208420591	NA	5.87E-06	mr1620	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208420591	NA	3.90E-07	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251