Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208306379:

Variant ID: vg1208306379 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8306379
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCATCATAATTATCATGCCGCTAAATTAATCACTAAAAAAATTACCACTGGACTGCCCCCAAAATCTTTTTTTATTTTTTTTATCTTTATCATTCTAG[C/T]
TCTGCTTGCAACCACATGTCAAAACTTGTGCCGCTTGATCCAACGTGCTGGGAAGGTGGAGAAAAGCGGCTGAGAGCTCGGTGCTTCAGCGTCGGAGCTC

Reverse complement sequence

GAGCTCCGACGCTGAAGCACCGAGCTCTCAGCCGCTTTTCTCCACCTTCCCAGCACGTTGGATCAAGCGGCACAAGTTTTGACATGTGGTTGCAAGCAGA[G/A]
CTAGAATGATAAAGATAAAAAAAATAAAAAAAGATTTTGGGGGCAGTCCAGTGGTAATTTTTTTAGTGATTAATTTAGCGGCATGATAATTATGATGCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	29.50%	0.19%	20.29%	NA
All Indica	2759	25.40%	48.50%	0.22%	25.92%	NA
All Japonica	1512	95.70%	2.00%	0.20%	2.12%	NA
Aus	269	33.80%	1.10%	0.00%	65.06%	NA
Indica I	595	42.20%	34.50%	0.50%	22.86%	NA
Indica II	465	24.70%	41.50%	0.22%	33.55%	NA
Indica III	913	14.50%	59.70%	0.11%	25.74%	NA
Indica Intermediate	786	25.80%	50.10%	0.13%	23.92%	NA
Temperate Japonica	767	94.70%	1.40%	0.39%	3.52%	NA
Tropical Japonica	504	96.00%	3.40%	0.00%	0.60%	NA
Japonica Intermediate	241	98.30%	0.80%	0.00%	0.83%	NA
VI/Aromatic	96	62.50%	6.20%	0.00%	31.25%	NA
Intermediate	90	73.30%	18.90%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208306379	C -> DEL	N	N	silent_mutation	Average:39.255; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg1208306379	C -> T	LOC_Os12g14550.1	upstream_gene_variant ; 16.0bp to feature; MODIFIER	silent_mutation	Average:39.255; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg1208306379	C -> T	LOC_Os12g14540.1	downstream_gene_variant ; 4295.0bp to feature; MODIFIER	silent_mutation	Average:39.255; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N
vg1208306379	C -> T	LOC_Os12g14540-LOC_Os12g14550	intergenic_region ; MODIFIER	silent_mutation	Average:39.255; most accessible tissue: Minghui63 young leaf, score: 71.254	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208306379	NA	1.44E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208306379	4.96E-06	NA	mr1397	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208306379	NA	5.14E-07	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208306379	NA	6.18E-07	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208306379	NA	1.77E-06	mr1851	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251