Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208301005:

Variant ID: vg1208301005 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8301005
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, A: 0.38, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAATTAATCCGTCATTAGCAAATATTTACTGTACCACCACATTGTTAAATCATTAAGCAATTAGGCTTAAAATATTCATCTCGCAAATTAGTTGTAAT[A/C]
TGTGTAATTAGTTATTTTTTTAAGTCTATATTTAATACTTTATGTTGGTATTCAAACGTTCGATGTGATATGATGAAAAATTTTAGGTACCTTGATAGAT

Reverse complement sequence

ATCTATCAAGGTACCTAAAATTTTTCATCATATCACATCGAACGTTTGAATACCAACATAAAGTATTAAATATAGACTTAAAAAAATAACTAATTACACA[T/G]
ATTACAACTAATTTGCGAGATGAATATTTTAAGCCTAATTGCTTAATGATTTAACAATGTGGTGGTACAGTAAATATTTGCTAATGACGGATTAATTAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 24.00% 0.80% 26.24% NA
All Indica  2759 48.50% 14.80% 0.69% 36.10% NA
All Japonica  1512 53.20% 42.50% 0.53% 3.84% NA
Aus  269 33.10% 13.40% 2.97% 50.56% NA
Indica I  595 31.30% 24.50% 1.85% 42.35% NA
Indica II  465 41.90% 12.00% 0.43% 45.59% NA
Indica III  913 61.10% 10.20% 0.11% 28.59% NA
Indica Intermediate  786 50.60% 14.20% 0.64% 34.48% NA
Temperate Japonica  767 25.90% 67.80% 0.78% 5.48% NA
Tropical Japonica  504 86.50% 11.30% 0.00% 2.18% NA
Japonica Intermediate  241 70.10% 27.00% 0.83% 2.07% NA
VI/Aromatic  96 35.40% 21.90% 1.04% 41.67% NA
Intermediate  90 54.40% 32.20% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208301005 A -> C LOC_Os12g14540.1 upstream_gene_variant ; 410.0bp to feature; MODIFIER silent_mutation Average:57.869; most accessible tissue: Minghui63 young leaf, score: 97.514 N N N N
vg1208301005 A -> C LOC_Os12g14530.1 downstream_gene_variant ; 1970.0bp to feature; MODIFIER silent_mutation Average:57.869; most accessible tissue: Minghui63 young leaf, score: 97.514 N N N N
vg1208301005 A -> C LOC_Os12g14530-LOC_Os12g14540 intergenic_region ; MODIFIER silent_mutation Average:57.869; most accessible tissue: Minghui63 young leaf, score: 97.514 N N N N
vg1208301005 A -> DEL N N silent_mutation Average:57.869; most accessible tissue: Minghui63 young leaf, score: 97.514 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1208301005 A C 0.01 0.03 0.03 0.02 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208301005 NA 4.89E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208301005 NA 2.46E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208301005 NA 4.02E-10 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 4.29E-07 1.61E-14 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 3.30E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 9.94E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 9.85E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 8.70E-09 mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 6.74E-07 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 5.00E-12 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 5.69E-10 9.66E-21 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 1.45E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 5.31E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 1.94E-11 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 4.28E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 3.25E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 4.27E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208301005 NA 2.72E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251