Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208272321:

Variant ID: vg1208272321 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8272321
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATATGCTGCCGTTGTTGGGCGTCCGCCGACTGGTGTCCTCGTCTATACGGTTGATTGGTCACACCACCGTACATGGGCGTCTACGTCTTCACCGACCG[A/G]
CTGGCCTTCGCCGCCGCCGACTGGTGTTTCCGCCTGCACGGCTGGCCTATTATGCCGCCGTTGTTGGGCGTCCACGACTTCACCGTCGTCCTGCCTCTGT

Reverse complement sequence

ACAGAGGCAGGACGACGGTGAAGTCGTGGACGCCCAACAACGGCGGCATAATAGGCCAGCCGTGCAGGCGGAAACACCAGTCGGCGGCGGCGAAGGCCAG[T/C]
CGGTCGGTGAAGACGTAGACGCCCATGTACGGTGGTGTGACCAATCAACCGTATAGACGAGGACACCAGTCGGCGGACGCCCAACAACGGCAGCATATAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 0.30% 11.36% 38.51% NA
All Indica  2759 54.80% 0.30% 15.98% 28.85% NA
All Japonica  1512 45.20% 0.20% 2.38% 52.25% NA
Aus  269 31.20% 0.00% 7.81% 60.97% NA
Indica I  595 43.50% 0.20% 6.72% 49.58% NA
Indica II  465 51.00% 1.50% 16.99% 30.54% NA
Indica III  913 62.90% 0.10% 23.22% 13.80% NA
Indica Intermediate  786 56.40% 0.00% 13.99% 29.64% NA
Temperate Japonica  767 68.10% 0.10% 1.83% 29.99% NA
Tropical Japonica  504 17.50% 0.40% 2.98% 79.17% NA
Japonica Intermediate  241 30.30% 0.00% 2.90% 66.80% NA
VI/Aromatic  96 26.00% 1.00% 34.38% 38.54% NA
Intermediate  90 55.60% 1.10% 6.67% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208272321 A -> DEL LOC_Os12g14490.1 N frameshift_variant Average:46.287; most accessible tissue: Minghui63 young leaf, score: 86.199 N N N N
vg1208272321 A -> G LOC_Os12g14490.1 missense_variant ; p.Asp119Gly; MODERATE nonsynonymous_codon ; D119G Average:46.287; most accessible tissue: Minghui63 young leaf, score: 86.199 unknown unknown TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1208272321 A G 0.01 0.02 0.01 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208272321 1.04E-08 9.99E-09 mr1750_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251