Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208226380:

Variant ID: vg1208226380 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8226380
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTGATTTAAATATATATCGATATAAGAATTATATATTGTTAATATGTATAGCCGATCGAATAGATTTAGTCCTTTATTATCTAGTTCCAACTGCCGAT[T/C]
GATTTACATATGACATCGGCTCAGAGATAAATGATATGTCATCGGCATCTAGCCGATCAGCTATCATTTATAGGTTTAACTGCGGTTTCTTTGTCTTTAT

Reverse complement sequence

ATAAAGACAAAGAAACCGCAGTTAAACCTATAAATGATAGCTGATCGGCTAGATGCCGATGACATATCATTTATCTCTGAGCCGATGTCATATGTAAATC[A/G]
ATCGGCAGTTGGAACTAGATAATAAAGGACTAAATCTATTCGATCGGCTATACATATTAACAATATATAATTCTTATATCGATATATATTTAAATCAAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.30%	25.40%	1.57%	26.75%	NA
All Indica	2759	49.90%	36.40%	1.81%	11.92%	NA
All Japonica	1512	45.30%	4.40%	0.99%	49.34%	NA
Aus	269	21.60%	29.00%	1.49%	47.96%	NA
Indica I	595	37.30%	46.90%	0.67%	15.13%	NA
Indica II	465	41.70%	49.20%	1.72%	7.31%	NA
Indica III	913	61.30%	25.20%	1.86%	11.61%	NA
Indica Intermediate	786	50.90%	33.80%	2.67%	12.60%	NA
Temperate Japonica	767	69.00%	6.30%	0.26%	24.51%	NA
Tropical Japonica	504	16.50%	2.00%	1.39%	80.16%	NA
Japonica Intermediate	241	30.30%	3.30%	2.49%	63.90%	NA
VI/Aromatic	96	25.00%	35.40%	3.12%	36.46%	NA
Intermediate	90	51.10%	18.90%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208226380	T -> C	LOC_Os12g14420.1	downstream_gene_variant ; 4963.0bp to feature; MODIFIER	silent_mutation	Average:29.204; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1208226380	T -> C	LOC_Os12g14430.1	downstream_gene_variant ; 2453.0bp to feature; MODIFIER	silent_mutation	Average:29.204; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1208226380	T -> C	LOC_Os12g14420-LOC_Os12g14430	intergenic_region ; MODIFIER	silent_mutation	Average:29.204; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1208226380	T -> DEL	N	N	silent_mutation	Average:29.204; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208226380	NA	1.80E-06	mr1049	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208226380	NA	1.67E-08	mr1425	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208226380	NA	5.40E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208226380	5.95E-07	3.93E-08	mr1040_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208226380	NA	6.00E-06	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208226380	NA	8.99E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208226380	NA	7.71E-06	mr1735_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208226380	1.19E-06	1.19E-06	mr1852_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208226380	NA	1.38E-09	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251