Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208089057:

Variant ID: vg1208089057 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8089057
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGGCAACAACCCCTAGATAGAGCAAAATATACCAACGATAATCCTTAGGATCGGAGGGGGGGGGGTGCAGCGAAAATGGGGCACCCCCCGACGCGTGG[G/A]
CGCGCGCCCGTAGGGCCCCACCACGTCTCCCCTGCCATACTGTCACGTGTCCCCACCATGCAGGACGTTGCAACAAATCACCCACTTATTTTGAAAACCC

Reverse complement sequence

GGGTTTTCAAAATAAGTGGGTGATTTGTTGCAACGTCCTGCATGGTGGGGACACGTGACAGTATGGCAGGGGAGACGTGGTGGGGCCCTACGGGCGCGCG[C/T]
CCACGCGTCGGGGGGTGCCCCATTTTCGCTGCACCCCCCCCCCTCCGATCCTAAGGATTATCGTTGGTATATTTTGCTCTATCTAGGGGTTGTTGCCTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 31.60% 1.02% 6.52% NA
All Indica  2759 41.80% 45.50% 1.63% 11.05% NA
All Japonica  1512 98.10% 1.80% 0.07% 0.00% NA
Aus  269 33.10% 66.50% 0.00% 0.37% NA
Indica I  595 52.60% 32.80% 1.68% 12.94% NA
Indica II  465 56.80% 35.70% 1.94% 5.59% NA
Indica III  913 28.70% 56.60% 1.10% 13.58% NA
Indica Intermediate  786 40.10% 48.00% 2.04% 9.92% NA
Temperate Japonica  767 99.20% 0.70% 0.13% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 70.00% 25.60% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208089057 G -> DEL N N silent_mutation Average:70.36; most accessible tissue: Minghui63 root, score: 86.617 N N N N
vg1208089057 G -> A LOC_Os12g14230.1 upstream_gene_variant ; 4259.0bp to feature; MODIFIER silent_mutation Average:70.36; most accessible tissue: Minghui63 root, score: 86.617 N N N N
vg1208089057 G -> A LOC_Os12g14230-LOC_Os12g14240 intergenic_region ; MODIFIER silent_mutation Average:70.36; most accessible tissue: Minghui63 root, score: 86.617 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1208089057 G A 0.14 0.06 0.03 0.06 0.08 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208089057 NA 6.20E-06 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208089057 NA 2.91E-13 mr1425 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208089057 NA 6.18E-09 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208089057 NA 7.42E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208089057 NA 1.07E-08 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208089057 NA 5.27E-08 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208089057 NA 3.19E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208089057 NA 8.00E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251