Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208048440:

Variant ID: vg1208048440 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8048440
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

AATATGGATGCTACATATCTGCTGACGAGGCGAATGCAGATAGAACACACAGGCAACCAAAACCCTTCCTATCCAAGATTTCTAGACTTATCTCTAACGT[A/T]
ATCATCAGCAAACTCCTAGATTTCTAGAAATGTTGTATTTGAACGAAATGTTCTGTTTACCAATTTGTCTTGGTCGGTACCGTGCAGGCAGTAACCTGAC

Reverse complement sequence

GTCAGGTTACTGCCTGCACGGTACCGACCAAGACAAATTGGTAAACAGAACATTTCGTTCAAATACAACATTTCTAGAAATCTAGGAGTTTGCTGATGAT[T/A]
ACGTTAGAGATAAGTCTAGAAATCTTGGATAGGAAGGGTTTTGGTTGCCTGTGTGTTCTATCTGCATTCGCCTCGTCAGCAGATATGTAGCATCCATATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.70%	7.00%	4.80%	11.43%	NA
All Indica	2759	86.90%	0.80%	5.18%	7.10%	NA
All Japonica	1512	53.00%	19.90%	5.22%	21.83%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	85.90%	0.70%	2.86%	10.59%	NA
Indica II	465	93.30%	0.60%	1.72%	4.30%	NA
Indica III	913	85.10%	0.90%	8.11%	5.91%	NA
Indica Intermediate	786	86.00%	0.90%	5.60%	7.51%	NA
Temperate Japonica	767	78.20%	2.60%	1.43%	17.73%	NA
Tropical Japonica	504	23.20%	48.40%	11.51%	16.87%	NA
Japonica Intermediate	241	35.30%	15.40%	4.15%	45.23%	NA
VI/Aromatic	96	93.80%	1.00%	1.04%	4.17%	NA
Intermediate	90	78.90%	6.70%	3.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208048440	A -> DEL	N	N	silent_mutation	Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1208048440	A -> T	LOC_Os12g14170.1	upstream_gene_variant ; 391.0bp to feature; MODIFIER	silent_mutation	Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1208048440	A -> T	LOC_Os12g14180.1	downstream_gene_variant ; 2365.0bp to feature; MODIFIER	silent_mutation	Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg1208048440	A -> T	LOC_Os12g14170-LOC_Os12g14180	intergenic_region ; MODIFIER	silent_mutation	Average:47.91; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208048440	8.29E-06	NA	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	NA	7.91E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	NA	7.54E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	NA	1.29E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	NA	4.24E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	4.76E-06	NA	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	NA	7.85E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	NA	6.63E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	8.64E-06	8.64E-06	mr1436	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	9.59E-08	NA	mr1132_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208048440	8.26E-06	NA	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251