Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208009403:

Variant ID: vg1208009403 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 8009403
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.18, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCCAATATGACATCGGCATCGGCTCGAAGATAAATGATATGCCATCGGCAACTAGCCGATCGGCTATCGTATATGGATTTAACCGTGGTTTTCTTGT[C/T]
TTTCTTTCTTGTTGATTACAGGATCAAATCAACTAGCACGCTCACGAACCTAAAAGCAAGATTTTGGACCTGCACTGAAGTTAAGTAGATCTTCTAGGCC

Reverse complement sequence

GGCCTAGAAGATCTACTTAACTTCAGTGCAGGTCCAAAATCTTGCTTTTAGGTTCGTGAGCGTGCTAGTTGATTTGATCCTGTAATCAACAAGAAAGAAA[G/A]
ACAAGAAAACCACGGTTAAATCCATATACGATAGCCGATCGGCTAGTTGCCGATGGCATATCATTTATCTTCGAGCCGATGCCGATGTCATATTGGAATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	28.20%	0.44%	17.18%	NA
All Indica	2759	80.40%	18.80%	0.14%	0.69%	NA
All Japonica	1512	5.80%	42.30%	0.99%	50.93%	NA
Aus	269	66.90%	32.30%	0.00%	0.74%	NA
Indica I	595	77.10%	21.80%	0.34%	0.67%	NA
Indica II	465	86.90%	12.70%	0.00%	0.43%	NA
Indica III	913	81.40%	18.20%	0.11%	0.33%	NA
Indica Intermediate	786	77.90%	20.70%	0.13%	1.27%	NA
Temperate Japonica	767	6.60%	66.80%	0.65%	25.95%	NA
Tropical Japonica	504	5.40%	11.70%	1.19%	81.75%	NA
Japonica Intermediate	241	3.70%	28.60%	1.66%	65.98%	NA
VI/Aromatic	96	42.70%	52.10%	0.00%	5.21%	NA
Intermediate	90	36.70%	43.30%	2.22%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1208009403	C -> DEL	N	N	silent_mutation	Average:27.049; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg1208009403	C -> T	LOC_Os12g14110.1	upstream_gene_variant ; 4904.0bp to feature; MODIFIER	silent_mutation	Average:27.049; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg1208009403	C -> T	LOC_Os12g14120.1	downstream_gene_variant ; 2424.0bp to feature; MODIFIER	silent_mutation	Average:27.049; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N
vg1208009403	C -> T	LOC_Os12g14110-LOC_Os12g14120	intergenic_region ; MODIFIER	silent_mutation	Average:27.049; most accessible tissue: Minghui63 root, score: 40.262	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1208009403	NA	8.84E-07	mr1111	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	1.33E-06	1.33E-06	mr1144	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	1.88E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	3.08E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	9.45E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	3.47E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	4.92E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	1.88E-08	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	2.27E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	2.91E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208009403	NA	3.70E-08	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251