Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207993699:

Variant ID: vg1207993699 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7993699
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

GCAAATAATATATTTGCAAACACATATAGATGTACAAATCGTGGCTCAAGGTTAGCCTATTTGGGTCAATATTATTTCTGCTTGTTGCTGCACCTGGTGT[C/T]
ATAATGTAACAGGGGGTTGAGCTCAGAAACAGACACAGGTTTAATCCTAAGATGCCCACAACAGCTTATTAACTTGCGCATGTTTCTCTACTGAATACAT

Reverse complement sequence

ATGTATTCAGTAGAGAAACATGCGCAAGTTAATAAGCTGTTGTGGGCATCTTAGGATTAAACCTGTGTCTGTTTCTGAGCTCAACCCCCTGTTACATTAT[G/A]
ACACCAGGTGCAGCAACAAGCAGAAATAATATTGACCCAAATAGGCTAACCTTGAGCCACGATTTGTACATCTATATGTGTTTGCAAATATATTATTTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.30%	0.50%	0.17%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	97.90%	1.60%	0.53%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	96.00%	3.10%	0.91%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207993699	C -> T	LOC_Os12g14090.1	upstream_gene_variant ; 1700.0bp to feature; MODIFIER	N	Average:78.54; most accessible tissue: Callus, score: 90.629	N	N	N	N
vg1207993699	C -> T	LOC_Os12g14100.1	upstream_gene_variant ; 3684.0bp to feature; MODIFIER	N	Average:78.54; most accessible tissue: Callus, score: 90.629	N	N	N	N
vg1207993699	C -> T	LOC_Os12g14070.1	downstream_gene_variant ; 1746.0bp to feature; MODIFIER	N	Average:78.54; most accessible tissue: Callus, score: 90.629	N	N	N	N
vg1207993699	C -> T	LOC_Os12g14080.1	intron_variant ; MODIFIER	N	Average:78.54; most accessible tissue: Callus, score: 90.629	N	N	N	N
vg1207993699	C -> T	LOC_Os12g14080.2	intron_variant ; MODIFIER	N	Average:78.54; most accessible tissue: Callus, score: 90.629	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1207993699	C	T	0.0	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207993699	NA	4.30E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1207993699	NA	8.84E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207993699	7.70E-07	7.70E-07	mr1343	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207993699	NA	8.47E-08	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207993699	NA	1.49E-06	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207993699	NA	1.41E-08	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251