Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207840086:

Variant ID: vg1207840086 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7840086
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CATGTTATTAACAAAATTAATCATCTCCATATATGATTTGATATGTTACAAAGCGGTAGTGCTGCGGTAGTCGTGATCACCTTAGATGCCTCAGACAAGA[T/C]
GCTTTGTCACGCATGCAAAAGGCAAAGGTGCATACGTGCATTGTGCAGCGGGCAAAAAAGAGAACTTCGGACGCTTTATTTATTAGCAAATAATATATAA

Reverse complement sequence

TTATATATTATTTGCTAATAAATAAAGCGTCCGAAGTTCTCTTTTTTGCCCGCTGCACAATGCACGTATGCACCTTTGCCTTTTGCATGCGTGACAAAGC[A/G]
TCTTGTCTGAGGCATCTAAGGTGATCACGACTACCGCAGCACTACCGCTTTGTAACATATCAAATCATATATGGAGATGATTAATTTTGTTAATAACATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.50% 3.60% 1.84% 52.05% NA
All Indica  2759 16.10% 6.10% 2.83% 74.95% NA
All Japonica  1512 95.60% 0.00% 0.07% 4.30% NA
Aus  269 10.00% 0.70% 2.23% 86.99% NA
Indica I  595 11.30% 12.30% 4.87% 71.60% NA
Indica II  465 24.70% 4.10% 0.86% 70.32% NA
Indica III  913 12.80% 4.50% 2.30% 80.39% NA
Indica Intermediate  786 18.60% 4.50% 3.05% 73.92% NA
Temperate Japonica  767 94.50% 0.00% 0.13% 5.35% NA
Tropical Japonica  504 96.20% 0.00% 0.00% 3.77% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 31.20% 0.00% 0.00% 68.75% NA
Intermediate  90 67.80% 0.00% 2.22% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207840086 T -> C LOC_Os12g13850.1 downstream_gene_variant ; 4943.0bp to feature; MODIFIER silent_mutation Average:12.091; most accessible tissue: Callus, score: 30.185 N N N N
vg1207840086 T -> C LOC_Os12g13850-LOC_Os12g13860 intergenic_region ; MODIFIER silent_mutation Average:12.091; most accessible tissue: Callus, score: 30.185 N N N N
vg1207840086 T -> DEL N N silent_mutation Average:12.091; most accessible tissue: Callus, score: 30.185 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207840086 NA 1.41E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.80E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 3.99E-18 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 3.15E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 2.42E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 3.21E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 1.78E-06 NA mr1216_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 6.83E-06 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.29E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 3.39E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.71E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 9.81E-09 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 6.32E-07 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.03E-21 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 9.39E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 4.49E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 3.11E-10 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 2.58E-06 7.23E-07 mr1516_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 4.13E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.87E-16 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.39E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.35E-11 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 2.04E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 2.00E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 7.05E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 2.43E-07 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 4.00E-13 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.31E-20 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 2.18E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.32E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 4.49E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 9.12E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 2.41E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.17E-12 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 1.05E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 4.59E-09 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 2.99E-19 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207840086 NA 3.68E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251