Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207573581:

Variant ID: vg1207573581 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 7573581
Reference Allele: GT	Alternative Allele: AT,G
Primary Allele: GT	Secondary Allele: AT

Inferred Ancestral Allele : GT (evidence from allele frequency in Oryza rufipogon: GT: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

AACTCAACTGATGCAGCTATAATTATGAAAAAAAGGACAATATCTAGACAATCAAGCCGTTGGATGTTTCATAGAGTGGTGGATATCCTATATAATCTAA[GT/AT,G]
CAACGTTGGTATTTAACCTAATCGGCTGCCTTCTAGCAACAGATGTTAGCCGATTGAAGGTTAGATAACAATATTGCCTAAGATTATATAGAATATATGA

Reverse complement sequence

TCATATATTCTATATAATCTTAGGCAATATTGTTATCTAACCTTCAATCGGCTAACATCTGTTGCTAGAAGGCAGCCGATTAGGTTAAATACCAACGTTG[AC/AT,C]
TTAGATTATATAGGATATCCACCACTCTATGAAACATCCAACGGCTTGATTGTCTAGATATTGTCCTTTTTTTCATAATTATAGCTGCATCAGTTGAGTT

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of AT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	5.10%	0.32%	0.89%	NA
All Indica	2759	89.20%	8.70%	0.54%	1.49%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.30%	5.90%	0.50%	1.34%	NA
Indica II	465	98.90%	0.90%	0.00%	0.22%	NA
Indica III	913	85.30%	11.50%	0.88%	2.30%	NA
Indica Intermediate	786	85.80%	12.30%	0.51%	1.40%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207573581	GT -> DEL	N	N	silent_mutation	Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg1207573581	GT -> AT	LOC_Os12g13490.1	upstream_gene_variant ; 991.0bp to feature; MODIFIER	silent_mutation	Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg1207573581	GT -> AT	LOC_Os12g13480-LOC_Os12g13490	intergenic_region ; MODIFIER	silent_mutation	Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg1207573581	GT -> G	LOC_Os12g13490.1	upstream_gene_variant ; 990.0bp to feature; MODIFIER	N	Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N
vg1207573581	GT -> G	LOC_Os12g13480-LOC_Os12g13490	intergenic_region ; MODIFIER	N	Average:38.031; most accessible tissue: Minghui63 flag leaf, score: 51.386	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207573581	4.05E-06	1.07E-07	mr1509	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251