Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207398363:

Variant ID: vg1207398363 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7398363
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CTGACTCGTAGTCGATAACAGGGTAGTCTTCCTCCTCGAGTTTGTTTCAGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACAGTATCCGGAGACAC[C/T]
GTAGGGGACTAGCCGTGCTTATTCCTGAAGTCGATATCCGGCGTCTTTGTCTTGGCGTATGTTGGCTTGTATGTTGTGGCTTCTGTTGTTCCGTATATGT

Reverse complement sequence

ACATATACGGAACAACAGAAGCCACAACATACAAGCCAACATACGCCAAGACAAAGACGCCGGATATCGACTTCAGGAATAAGCACGGCTAGTCCCCTAC[G/A]
GTGTCTCCGGATACTGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCTGAAACAAACTCGAGGAGGAAGACTACCCTGTTATCGACTACGAGTCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.20%	39.80%	0.06%	0.00%	NA
All Indica	2759	44.20%	55.70%	0.07%	0.00%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	10.00%	89.60%	0.37%	0.00%	NA
Indica I	595	67.70%	32.30%	0.00%	0.00%	NA
Indica II	465	54.60%	45.40%	0.00%	0.00%	NA
Indica III	913	27.90%	72.10%	0.00%	0.00%	NA
Indica Intermediate	786	39.20%	60.60%	0.25%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	67.70%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207398363	C -> T	LOC_Os12g13290.1	downstream_gene_variant ; 4512.0bp to feature; MODIFIER	silent_mutation	Average:56.377; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N
vg1207398363	C -> T	LOC_Os12g13290-LOC_Os12g13295	intergenic_region ; MODIFIER	silent_mutation	Average:56.377; most accessible tissue: Zhenshan97 flower, score: 78.677	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1207398363	C	T	0.06	0.03	0.02	0.06	0.06	0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207398363	NA	3.07E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	1.15E-06	mr1452_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	6.62E-06	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	6.67E-08	mr1539_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	6.94E-08	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	2.89E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	7.05E-06	mr1576_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	2.03E-08	mr1582_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	3.99E-07	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	6.29E-08	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	3.06E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207398363	NA	1.91E-08	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251