Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207192862:

Variant ID: vg1207192862 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7192862
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TAATCATCTAAAAGCTAAAAACAACTGATGTGATATGACTTAATTAGAGGAAAAAAGGAGAAAGATAATTCGGACCAAAATCATTTAAGCACTAAGTGAG[G/A]
ATGAACAATATAAGTATATAGGATATCATAAAAACATAAAAAGATATACATTGAAACATTATGTAAATTATATTGGATGATAATTTAACATGTTTGTATT

Reverse complement sequence

AATACAAACATGTTAAATTATCATCCAATATAATTTACATAATGTTTCAATGTATATCTTTTTATGTTTTTATGATATCCTATATACTTATATTGTTCAT[C/T]
CTCACTTAGTGCTTAAATGATTTTGGTCCGAATTATCTTTCTCCTTTTTTCCTCTAATTAAGTCATATCACATCAGTTGTTTTTAGCTTTTAGATGATTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.60%	41.30%	0.15%	0.00%	NA
All Indica	2759	89.50%	10.30%	0.22%	0.00%	NA
All Japonica	1512	2.90%	97.00%	0.07%	0.00%	NA
Aus	269	67.30%	32.70%	0.00%	0.00%	NA
Indica I	595	84.70%	14.80%	0.50%	0.00%	NA
Indica II	465	91.60%	8.20%	0.22%	0.00%	NA
Indica III	913	93.00%	7.00%	0.00%	0.00%	NA
Indica Intermediate	786	87.80%	12.00%	0.25%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	6.00%	93.80%	0.20%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	26.70%	73.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207192862	G -> A	LOC_Os12g12970.1	upstream_gene_variant ; 4700.0bp to feature; MODIFIER	silent_mutation	Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1207192862	G -> A	LOC_Os12g12990.1	upstream_gene_variant ; 1054.0bp to feature; MODIFIER	silent_mutation	Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1207192862	G -> A	LOC_Os12g12980.1	downstream_gene_variant ; 2029.0bp to feature; MODIFIER	silent_mutation	Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg1207192862	G -> A	LOC_Os12g12980-LOC_Os12g12990	intergenic_region ; MODIFIER	silent_mutation	Average:23.597; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207192862	NA	3.07E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	1.89E-06	1.89E-06	mr1025	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	4.23E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	5.18E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	3.43E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	7.00E-14	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	2.03E-10	mr1581	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	1.60E-07	mr1666	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	1.49E-10	mr1804	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	1.37E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207192862	NA	8.80E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251