Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207185563:

Variant ID: vg1207185563 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 7185563
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTTATTTTATATCGTTTCTCTCTCATCAATTGAATAGATATTATATTTTAATGCGTCTAGTGTTCTGCAACAAATTATCATTCTTTTTTAAGTGTCTT[T/C]
AGGTAAATTCACGATTTTACGATGTCCCACAGCTAATTATATATTTTTTTAAGTGTTCTATAGCAAATTTTGCCATATTTAAAAGATAGATCGGAGGTAC

Reverse complement sequence

GTACCTCCGATCTATCTTTTAAATATGGCAAAATTTGCTATAGAACACTTAAAAAAATATATAATTAGCTGTGGGACATCGTAAAATCGTGAATTTACCT[A/G]
AAGACACTTAAAAAAGAATGATAATTTGTTGCAGAACACTAGACGCATTAAAATATAATATCTATTCAATTGATGAGAGAGAAACGATATAAAATAACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.50% 0.02% 0.23% NA
All Indica  2759 97.00% 2.80% 0.00% 0.18% NA
All Japonica  1512 5.20% 94.60% 0.00% 0.20% NA
Aus  269 63.20% 36.80% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.00% 0.17% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 98.60% 1.20% 0.00% 0.22% NA
Indica Intermediate  786 94.80% 5.00% 0.00% 0.25% NA
Temperate Japonica  767 5.10% 94.90% 0.00% 0.00% NA
Tropical Japonica  504 6.20% 93.70% 0.00% 0.20% NA
Japonica Intermediate  241 3.70% 95.40% 0.00% 0.83% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 38.90% 56.70% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1207185563 T -> C LOC_Os12g12980.1 upstream_gene_variant ; 4721.0bp to feature; MODIFIER silent_mutation Average:48.74; most accessible tissue: Callus, score: 77.483 N N N N
vg1207185563 T -> C LOC_Os12g12970.1 intron_variant ; MODIFIER silent_mutation Average:48.74; most accessible tissue: Callus, score: 77.483 N N N N
vg1207185563 T -> DEL N N silent_mutation Average:48.74; most accessible tissue: Callus, score: 77.483 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1207185563 NA 5.15E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.12E-27 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 4.58E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 2.18E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 3.88E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.13E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.44E-10 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 4.30E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 8.39E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 2.59E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 8.21E-23 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 2.99E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 2.93E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 5.60E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.61E-08 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.86E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 2.59E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 8.10E-16 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 5.33E-59 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 2.28E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.42E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.39E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 4.35E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.98E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 5.48E-13 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.50E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 3.72E-22 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.19E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 1.31E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 5.73E-06 5.04E-25 mr1922_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 6.20E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 3.74E-11 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207185563 NA 5.16E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251