Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1207110670:

Variant ID: vg1207110670 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 7110670
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GCCTATATCATCATAGATCTAGGGACAAGGCCATCAACGCTAGGAACATTAAGGGCATGTTTGGTAGAGTTCCAACTCCTAAATTTAGTTATAGGAGTTG[G/T]
ATCTGGAGTGAAGTTGTAGAGTTGTATAAACCCAGCTCCATCTTTCTAGTTCATTTTATGAGAGCACTTCTATCAGTTCCGTTCTAATTTTTAGTGGAGC

Reverse complement sequence

GCTCCACTAAAAATTAGAACGGAACTGATAGAAGTGCTCTCATAAAATGAACTAGAAAGATGGAGCTGGGTTTATACAACTCTACAACTTCACTCCAGAT[C/A]
CAACTCCTATAACTAAATTTAGGAGTTGGAACTCTACCAAACATGCCCTTAATGTTCCTAGCGTTGATGGCCTTGTCCCTAGATCTATGATGATATAGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.90%	19.10%	0.04%	0.00%	NA
All Indica	2759	68.00%	32.00%	0.07%	0.00%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	48.40%	51.40%	0.17%	0.00%	NA
Indica II	465	44.70%	55.30%	0.00%	0.00%	NA
Indica III	913	93.90%	6.00%	0.11%	0.00%	NA
Indica Intermediate	786	66.40%	33.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1207110670	G -> T	LOC_Os12g12854.1	upstream_gene_variant ; 4273.0bp to feature; MODIFIER	silent_mutation	Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536	N	N	N	N
vg1207110670	G -> T	LOC_Os12g12860.1	upstream_gene_variant ; 1616.0bp to feature; MODIFIER	silent_mutation	Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536	N	N	N	N
vg1207110670	G -> T	LOC_Os12g12854-LOC_Os12g12860	intergenic_region ; MODIFIER	silent_mutation	Average:66.768; most accessible tissue: Zhenshan97 panicle, score: 91.536	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1207110670	NA	1.76E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	NA	1.59E-07	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	NA	6.13E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	NA	3.08E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	1.41E-06	4.21E-10	mr1024_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	NA	1.90E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	NA	2.70E-17	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	NA	5.58E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	NA	1.23E-08	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1207110670	NA	1.25E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251