Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206941863:

Variant ID: vg1206941863 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6941863
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.03, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGCATAACAAACTCATAAATATAATAGTCTAATCTAACAAATTTCTACACTCCAACAATGTACTCCATAAATTTATTATGTTTCTTCGTAGCAAAGGG[C/A]
AAAATGGACTTTTTCATAAGAATTTAACGGTCCACTGACGGTCAACTAGGGAAAAGGGCGTGCAACCGTGCAAGGGATCCAGACTAAAATTCAGGTGTAT

Reverse complement sequence

ATACACCTGAATTTTAGTCTGGATCCCTTGCACGGTTGCACGCCCTTTTCCCTAGTTGACCGTCAGTGGACCGTTAAATTCTTATGAAAAAGTCCATTTT[G/T]
CCCTTTGCTACGAAGAAACATAATAAATTTATGGAGTACATTGTTGGAGTGTAGAAATTTGTTAGATTAGACTATTATATTTATGAGTTTGTTATGCACC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.70%	17.80%	0.04%	0.53%	NA
All Indica	2759	70.90%	28.70%	0.07%	0.40%	NA
All Japonica	1512	97.30%	2.60%	0.00%	0.07%	NA
Aus	269	96.30%	0.00%	0.00%	3.72%	NA
Indica I	595	20.80%	79.00%	0.17%	0.00%	NA
Indica II	465	82.80%	17.00%	0.00%	0.22%	NA
Indica III	913	96.90%	2.30%	0.00%	0.77%	NA
Indica Intermediate	786	71.40%	28.10%	0.13%	0.38%	NA
Temperate Japonica	767	95.00%	5.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206941863	C -> DEL	N	N	silent_mutation	Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg1206941863	C -> A	LOC_Os12g12600.1	upstream_gene_variant ; 3343.0bp to feature; MODIFIER	silent_mutation	Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg1206941863	C -> A	LOC_Os12g12590.1	downstream_gene_variant ; 4792.0bp to feature; MODIFIER	silent_mutation	Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N
vg1206941863	C -> A	LOC_Os12g12590-LOC_Os12g12600	intergenic_region ; MODIFIER	silent_mutation	Average:33.25; most accessible tissue: Zhenshan97 young leaf, score: 42.553	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206941863	NA	7.10E-08	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863	NA	2.17E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863	NA	8.48E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863	NA	1.26E-13	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863	NA	4.01E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863	NA	1.68E-06	mr1549	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863	5.80E-07	8.16E-08	mr1673	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206941863	NA	9.24E-06	mr1680	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251