Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206771466:

Variant ID: vg1206771466 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6771466
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TATGTTGACATTGATAATCATCACATTTTAAACTCTTTTGACATCATAGTGTAAGTTAGAGCTGATGTTATTTCATTTCCCGTTGCAACGCACGGGCACC[C/T]
AACCAGTTTCCAAAATAAGCATATATACTTTACTTGCAAATGGTAATATTTTTCAACAATATAGATTCATACGAGAGAGCATATTGAAAACTCTGTCACT

Reverse complement sequence

AGTGACAGAGTTTTCAATATGCTCTCTCGTATGAATCTATATTGTTGAAAAATATTACCATTTGCAAGTAAAGTATATATGCTTATTTTGGAAACTGGTT[G/A]
GGTGCCCGTGCGTTGCAACGGGAAATGAAATAACATCAGCTCTAACTTACACTATGATGTCAAAAGAGTTTAAAATGTGATGATTATCAATGTCAACATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.30%	25.50%	0.19%	0.06%	NA
All Indica	2759	65.40%	34.10%	0.33%	0.11%	NA
All Japonica	1512	99.10%	0.90%	0.00%	0.00%	NA
Aus	269	42.80%	57.20%	0.00%	0.00%	NA
Indica I	595	28.20%	71.30%	0.50%	0.00%	NA
Indica II	465	94.40%	5.20%	0.22%	0.22%	NA
Indica III	913	80.70%	19.30%	0.00%	0.00%	NA
Indica Intermediate	786	58.70%	40.50%	0.64%	0.25%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	77.80%	22.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206771466	C -> DEL	N	N	silent_mutation	Average:52.807; most accessible tissue: Callus, score: 75.001	N	N	N	N
vg1206771466	C -> T	LOC_Os12g12310.1	downstream_gene_variant ; 527.0bp to feature; MODIFIER	silent_mutation	Average:52.807; most accessible tissue: Callus, score: 75.001	N	N	N	N
vg1206771466	C -> T	LOC_Os12g12300-LOC_Os12g12310	intergenic_region ; MODIFIER	silent_mutation	Average:52.807; most accessible tissue: Callus, score: 75.001	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206771466	NA	1.99E-10	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1206771466	NA	4.57E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206771466	NA	1.08E-06	mr1659	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206771466	NA	6.95E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206771466	NA	1.14E-06	mr1497_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206771466	NA	1.66E-08	mr1508_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206771466	NA	2.02E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251