Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206397770:

Variant ID: vg1206397770 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6397770
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

AGCATTTTCCACGCTAGGGTCCTGTTTGAAAGATTAGCCCAGGGCTAATTTTGAGGGGTAATGTTTAGTCATGAATTGGTAGGCTAAACATTAGCCTAGG[G/A]
TAGCATGTTTGGATCCATGGGCTAAATCAAGTCTAAAAGGTGGAGAGAAAGTAGAAAGAGAGGAGAGAGAATGAGAGAGAGCTGCATTTGATGGTCCCCA

Reverse complement sequence

TGGGGACCATCAAATGCAGCTCTCTCTCATTCTCTCTCCTCTCTTTCTACTTTCTCTCCACCTTTTAGACTTGATTTAGCCCATGGATCCAAACATGCTA[C/T]
CCTAGGCTAATGTTTAGCCTACCAATTCATGACTAAACATTACCCCTCAAAATTAGCCCTGGGCTAATCTTTCAAACAGGACCCTAGCGTGGAAAATGCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.50%	15.80%	0.53%	59.18%	NA
All Indica	2759	35.20%	3.30%	0.25%	61.18%	NA
All Japonica	1512	5.60%	38.20%	1.12%	55.03%	NA
Aus	269	2.20%	18.20%	0.37%	79.18%	NA
Indica I	595	85.50%	6.20%	0.17%	8.07%	NA
Indica II	465	18.70%	1.90%	0.22%	79.14%	NA
Indica III	913	10.80%	2.10%	0.33%	86.75%	NA
Indica Intermediate	786	35.20%	3.40%	0.25%	61.07%	NA
Temperate Japonica	767	9.60%	45.10%	1.30%	43.94%	NA
Tropical Japonica	504	1.00%	22.00%	0.60%	76.39%	NA
Japonica Intermediate	241	2.50%	50.20%	1.66%	45.64%	NA
VI/Aromatic	96	68.80%	10.40%	0.00%	20.83%	NA
Intermediate	90	32.20%	18.90%	0.00%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206397770	G -> DEL	N	N	silent_mutation	Average:59.961; most accessible tissue: Callus, score: 87.944	N	N	N	N
vg1206397770	G -> A	LOC_Os12g11790.1	upstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:59.961; most accessible tissue: Callus, score: 87.944	N	N	N	N
vg1206397770	G -> A	LOC_Os12g11800.1	upstream_gene_variant ; 2516.0bp to feature; MODIFIER	silent_mutation	Average:59.961; most accessible tissue: Callus, score: 87.944	N	N	N	N
vg1206397770	G -> A	LOC_Os12g11790-LOC_Os12g11800	intergenic_region ; MODIFIER	silent_mutation	Average:59.961; most accessible tissue: Callus, score: 87.944	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206397770	7.89E-06	3.95E-09	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	NA	1.13E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	NA	2.27E-07	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	NA	5.49E-06	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	NA	3.00E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	3.72E-08	NA	mr1549_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	NA	7.99E-07	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	NA	9.07E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	2.24E-07	NA	mr1757_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	1.89E-06	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206397770	7.98E-06	1.03E-07	mr1982_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251