Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206223802:

Variant ID: vg1206223802 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 6223802
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTAAATGAAATCGATGGTTAGATGCTTTACTTTTTTTTCTTAGAATTTCTATAATTTATTAGAGTGCAACATGGCGGTGTAAGAGCGTTTCTAGATATG[C/T]
CACGTGGCAGCTTAGGAGTGTTTATAAAAAGTTTAATGGACTTTTAGTATAAAATAGATTCAGATGCAAAGTAGATCAAGAAAAGCCCATATGTGAATCC

Reverse complement sequence

GGATTCACATATGGGCTTTTCTTGATCTACTTTGCATCTGAATCTATTTTATACTAAAAGTCCATTAAACTTTTTATAAACACTCCTAAGCTGCCACGTG[G/A]
CATATCTAGAAACGCTCTTACACCGCCATGTTGCACTCTAATAAATTATAGAAATTCTAAGAAAAAAAAGTAAAGCATCTAACCATCGATTTCATTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	1.70%	0.57%	25.88%	NA
All Indica	2759	95.50%	1.90%	0.04%	2.57%	NA
All Japonica	1512	32.60%	0.30%	1.26%	65.87%	NA
Aus	269	66.50%	7.40%	0.74%	25.28%	NA
Indica I	595	92.40%	6.40%	0.00%	1.18%	NA
Indica II	465	97.80%	0.00%	0.00%	2.15%	NA
Indica III	913	97.20%	0.30%	0.11%	2.41%	NA
Indica Intermediate	786	94.40%	1.50%	0.00%	4.07%	NA
Temperate Japonica	767	43.20%	0.00%	1.43%	55.41%	NA
Tropical Japonica	504	12.90%	0.20%	1.39%	85.52%	NA
Japonica Intermediate	241	40.20%	1.20%	0.41%	58.09%	NA
VI/Aromatic	96	35.40%	3.10%	3.12%	58.33%	NA
Intermediate	90	60.00%	2.20%	2.22%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1206223802	C -> DEL	N	N	silent_mutation	Average:73.936; most accessible tissue: Zhenshan97 root, score: 91.959	N	N	N	N
vg1206223802	C -> T	LOC_Os12g11500.1	upstream_gene_variant ; 442.0bp to feature; MODIFIER	silent_mutation	Average:73.936; most accessible tissue: Zhenshan97 root, score: 91.959	N	N	N	N
vg1206223802	C -> T	LOC_Os12g11490-LOC_Os12g11500	intergenic_region ; MODIFIER	silent_mutation	Average:73.936; most accessible tissue: Zhenshan97 root, score: 91.959	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1206223802	C	T	0.04	0.01	0.0	0.02	0.03	0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1206223802	NA	1.12E-14	mr1570	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206223802	NA	6.93E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206223802	NA	3.52E-07	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206223802	NA	5.70E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206223802	NA	7.67E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251