Search for Variation information by Variation ID:
Detailed information for vg1205950486:
| Variant ID: vg1205950486 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 5950486 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TAGTGAGAATTGAGCAACCTCGGCTTCATCTATAGCGTAAAACTCCATAGGCAACATACACACCATGTTGACATCCATGTCCTCCTTTGGAGATGATTCA[T/C]
CCTTAGCAACCGATTGTTCTTCCTTCTCCTTTTGCACAACAACCGGTTCTTCAATCTCTATGGATTTATGCCTCCACATCTTTGTAGGCAGTGGTCGCAA
Reverse complement sequence
TTGCGACCACTGCCTACAAAGATGTGGAGGCATAAATCCATAGAGATTGAAGAACCGGTTGTTGTGCAAAAGGAGAAGGAAGAACAATCGGTTGCTAAGG[A/G]
TGAATCATCTCCAAAGGAGGACATGGATGTCAACATGGTGTGTATGTTGCCTATGGAGTTTTACGCTATAGATGAAGCCGAGGTTGCTCAATTCTCACTA
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.00% | 36.60% | 14.26% | 9.18% | NA |
| All Indica | 2759 | 38.00% | 45.70% | 16.06% | 0.25% | NA |
| All Japonica | 1512 | 40.80% | 21.20% | 9.79% | 28.17% | NA |
| Aus | 269 | 61.00% | 17.80% | 21.19% | 0.00% | NA |
| Indica I | 595 | 49.90% | 32.90% | 17.14% | 0.00% | NA |
| Indica II | 465 | 60.00% | 22.80% | 16.56% | 0.65% | NA |
| Indica III | 913 | 16.90% | 68.50% | 14.68% | 0.00% | NA |
| Indica Intermediate | 786 | 40.50% | 42.50% | 16.54% | 0.51% | NA |
| Temperate Japonica | 767 | 50.10% | 3.50% | 11.73% | 34.68% | NA |
| Tropical Japonica | 504 | 22.00% | 51.60% | 6.55% | 19.84% | NA |
| Japonica Intermediate | 241 | 50.60% | 14.10% | 10.37% | 24.90% | NA |
| VI/Aromatic | 96 | 13.50% | 72.90% | 13.54% | 0.00% | NA |
| Intermediate | 90 | 52.20% | 32.20% | 14.44% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1205950486 | T -> C | LOC_Os12g11030.1 | missense_variant ; p.Asp581Gly; MODERATE | nonsynonymous_codon ; D581G | Average:22.793; most accessible tissue: Callus, score: 31.39 | possibly damaging  |
1.505 |
TOLERATED | 0.58 |
| vg1205950486 | T -> DEL | LOC_Os12g11030.1 | N | frameshift_variant | Average:22.793; most accessible tissue: Callus, score: 31.39 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1205950486 | NA | 1.19E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205950486 | 3.79E-06 | 2.55E-08 | mr1450 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205950486 | NA | 6.79E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205950486 | NA | 7.07E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1205950486 | NA | 1.67E-07 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |