Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205848936:

Variant ID: vg1205848936 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5848936
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.60, T: 0.41, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTTTGTTTCCTCACGTGGTTTCCTTTTTGGCACCGCATTACTTTCCTATTTTAGTAAATTTTTGCACCTAAAGTTTTTACATCTTAAATTTACAC[A/T]
TCTAAAGTTTATACACCTAGAGTTTATAGATCCAAAGTTTATAAGTTAAAAGTTTATATACCCGATTCAAATTTGAATTTAAATTTAAATATTTTTTATA

Reverse complement sequence

TATAAAAAATATTTAAATTTAAATTCAAATTTGAATCGGGTATATAAACTTTTAACTTATAAACTTTGGATCTATAAACTCTAGGTGTATAAACTTTAGA[T/A]
GTGTAAATTTAAGATGTAAAAACTTTAGGTGCAAAAATTTACTAAAATAGGAAAGTAATGCGGTGCCAAAAAGGAAACCACGTGAGGAAACAAAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.20%	16.90%	0.32%	57.58%	NA
All Indica	2759	37.20%	10.00%	0.36%	52.48%	NA
All Japonica	1512	3.40%	20.50%	0.26%	75.86%	NA
Aus	269	8.60%	62.50%	0.37%	28.62%	NA
Indica I	595	91.60%	2.90%	0.50%	5.04%	NA
Indica II	465	18.30%	5.40%	0.65%	75.70%	NA
Indica III	913	11.50%	12.00%	0.00%	76.45%	NA
Indica Intermediate	786	36.90%	15.80%	0.51%	46.82%	NA
Temperate Japonica	767	5.30%	28.20%	0.39%	66.10%	NA
Tropical Japonica	504	0.80%	3.60%	0.20%	95.44%	NA
Japonica Intermediate	241	2.50%	31.50%	0.00%	65.98%	NA
VI/Aromatic	96	68.80%	28.10%	0.00%	3.12%	NA
Intermediate	90	31.10%	17.80%	0.00%	51.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205848936	A -> DEL	N	N	silent_mutation	Average:25.557; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1205848936	A -> T	LOC_Os12g10840.1	upstream_gene_variant ; 1030.0bp to feature; MODIFIER	silent_mutation	Average:25.557; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1205848936	A -> T	LOC_Os12g10850.1	upstream_gene_variant ; 823.0bp to feature; MODIFIER	silent_mutation	Average:25.557; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N
vg1205848936	A -> T	LOC_Os12g10840-LOC_Os12g10850	intergenic_region ; MODIFIER	silent_mutation	Average:25.557; most accessible tissue: Minghui63 panicle, score: 53.77	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205848936	NA	8.71E-18	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936	NA	2.37E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936	NA	1.44E-13	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936	NA	1.30E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936	NA	1.29E-20	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205848936	1.92E-06	6.68E-07	mr1632_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251