Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205581996:

Variant ID: vg1205581996 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5581996
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.18, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAATGCCTGCGTGGAAGCGCCTTCAATTCCCTTCCATCCTGTAGTGTTATGAGCTCACCACTTATGACCAACAAGCCTAATTAGAAGATGTTAGGAAA[A/G]
TTAATCTCTCGGCTAAGGAAATCGGGAGAAAATCATGCGTTACCGTTTTCCACCCGTTAACCAGCGTGATTAGCTAAATCAAATCACGATTAAATTTCCT

Reverse complement sequence

AGGAAATTTAATCGTGATTTGATTTAGCTAATCACGCTGGTTAACGGGTGGAAAACGGTAACGCATGATTTTCTCCCGATTTCCTTAGCCGAGAGATTAA[T/C]
TTTCCTAACATCTTCTAATTAGGCTTGTTGGTCATAAGTGGTGAGCTCATAACACTACAGGATGGAAGGGAATTGAAGGCGCTTCCACGCAGGCATTCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.00%	0.28%	0.00%	NA
All Indica	2759	92.90%	6.70%	0.40%	0.00%	NA
All Japonica	1512	97.20%	2.80%	0.00%	0.00%	NA
Aus	269	80.30%	19.70%	0.00%	0.00%	NA
Indica I	595	84.40%	15.50%	0.17%	0.00%	NA
Indica II	465	96.30%	3.70%	0.00%	0.00%	NA
Indica III	913	96.10%	3.10%	0.88%	0.00%	NA
Indica Intermediate	786	93.50%	6.20%	0.25%	0.00%	NA
Temperate Japonica	767	95.70%	4.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	3.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205581996	A -> G	LOC_Os12g10530.1	upstream_gene_variant ; 3439.0bp to feature; MODIFIER	silent_mutation	Average:58.435; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1205581996	A -> G	LOC_Os12g10540.1	upstream_gene_variant ; 3207.0bp to feature; MODIFIER	silent_mutation	Average:58.435; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1205581996	A -> G	LOC_Os12g10540.2	upstream_gene_variant ; 2597.0bp to feature; MODIFIER	silent_mutation	Average:58.435; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1205581996	A -> G	LOC_Os12g10540.4	upstream_gene_variant ; 2779.0bp to feature; MODIFIER	silent_mutation	Average:58.435; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1205581996	A -> G	LOC_Os12g10540.5	upstream_gene_variant ; 2794.0bp to feature; MODIFIER	silent_mutation	Average:58.435; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1205581996	A -> G	LOC_Os12g10540.3	upstream_gene_variant ; 4135.0bp to feature; MODIFIER	silent_mutation	Average:58.435; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N
vg1205581996	A -> G	LOC_Os12g10530-LOC_Os12g10540	intergenic_region ; MODIFIER	silent_mutation	Average:58.435; most accessible tissue: Zhenshan97 flag leaf, score: 71.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205581996	NA	6.73E-06	mr1136	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205581996	NA	2.02E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205581996	1.21E-06	1.21E-06	mr1551	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251