Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1205541281:

Variant ID: vg1205541281 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 5541281
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCCTTGTTTAGTTGGGAAAAATTTTTAGGTTTGGTTGTCATATCGGATATACGGACACACATTGAAGTATTAAACGTAGTTTAATAACAAAACAAATTA[T/C]
AGATTCCGCCAGGAAATTGCGAGATGAATTTATTAAGCCTAATTAATCTATCATTAGCAAATGTTTACTGTAGCACCACATTGTCAAATACTGACGCAAT

Reverse complement sequence

ATTGCGTCAGTATTTGACAATGTGGTGCTACAGTAAACATTTGCTAATGATAGATTAATTAGGCTTAATAAATTCATCTCGCAATTTCCTGGCGGAATCT[A/G]
TAATTTGTTTTGTTATTAAACTACGTTTAATACTTCAATGTGTGTCCGTATATCCGATATGACAACCAAACCTAAAAATTTTTCCCAACTAAACAAGGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.10%	42.40%	0.66%	5.88%	NA
All Indica	2759	25.10%	68.90%	0.83%	5.15%	NA
All Japonica	1512	96.40%	3.60%	0.00%	0.00%	NA
Aus	269	40.90%	8.20%	1.86%	49.07%	NA
Indica I	595	62.40%	30.80%	0.84%	6.05%	NA
Indica II	465	17.20%	77.40%	0.65%	4.73%	NA
Indica III	913	3.20%	92.70%	0.44%	3.72%	NA
Indica Intermediate	786	27.00%	65.30%	1.40%	6.36%	NA
Temperate Japonica	767	95.40%	4.60%	0.00%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	0.00%	1.04%	NA
Intermediate	90	70.00%	23.30%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1205541281	T -> C	LOC_Os12g10440.1	upstream_gene_variant ; 4514.0bp to feature; MODIFIER	silent_mutation	Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1205541281	T -> C	LOC_Os12g10450.1	downstream_gene_variant ; 1268.0bp to feature; MODIFIER	silent_mutation	Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1205541281	T -> C	LOC_Os12g10460.1	downstream_gene_variant ; 2025.0bp to feature; MODIFIER	silent_mutation	Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1205541281	T -> C	LOC_Os12g10450-LOC_Os12g10460	intergenic_region ; MODIFIER	silent_mutation	Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N
vg1205541281	T -> DEL	N	N	silent_mutation	Average:71.997; most accessible tissue: Minghui63 panicle, score: 86.85	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1205541281	NA	5.59E-07	mr1040	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	2.20E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	1.56E-18	mr1179	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	3.71E-10	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	3.24E-06	mr1203	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	8.33E-06	8.33E-06	mr1205	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	4.63E-15	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	6.63E-13	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	4.21E-06	3.01E-06	mr1281	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	6.99E-07	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	7.32E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	1.85E-14	mr1362	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	2.07E-16	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	2.91E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1205541281	NA	1.42E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251