Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204930683:

Variant ID: vg1204930683 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4930683
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.66, A: 0.33, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGCTGAGAGAAGAGACCCTTGAAAATGGCTCATTTTCATGATGTACTTCTCTTCTATTCTGCATGGTAGGATGGCTTATGCCTTAATGTGGTCCTAGT[A/G]
GCTTTTCTAAGCAGAGATGTTGACCTGCAGAACATCTCAGAAGGAACACACCTATATGAGTTCGACTGCTAGTCACAGTCTATGAGATTTGGACGATCTC

Reverse complement sequence

GAGATCGTCCAAATCTCATAGACTGTGACTAGCAGTCGAACTCATATAGGTGTGTTCCTTCTGAGATGTTCTGCAGGTCAACATCTCTGCTTAGAAAAGC[T/C]
ACTAGGACCACATTAAGGCATAAGCCATCCTACCATGCAGAATAGAAGAGAAGTACATCATGAAAATGAGCCATTTTCAAGGGTCTCTTCTCTCAGCCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.30%	16.40%	15.04%	29.28%	NA
All Indica	2759	10.40%	15.20%	25.15%	49.22%	NA
All Japonica	1512	90.80%	7.90%	0.66%	0.66%	NA
Aus	269	13.80%	85.90%	0.00%	0.37%	NA
Indica I	595	15.10%	11.30%	26.39%	47.23%	NA
Indica II	465	8.80%	13.80%	27.10%	50.32%	NA
Indica III	913	6.20%	15.80%	25.41%	52.57%	NA
Indica Intermediate	786	12.70%	18.30%	22.77%	46.18%	NA
Temperate Japonica	767	95.70%	3.50%	0.13%	0.65%	NA
Tropical Japonica	504	94.00%	3.40%	1.59%	0.99%	NA
Japonica Intermediate	241	68.50%	31.10%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	71.10%	5.60%	6.67%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204930683	A -> DEL	N	N	silent_mutation	Average:15.626; most accessible tissue: Callus, score: 20.564	N	N	N	N
vg1204930683	A -> G	LOC_Os12g09410.1	upstream_gene_variant ; 1019.0bp to feature; MODIFIER	silent_mutation	Average:15.626; most accessible tissue: Callus, score: 20.564	N	N	N	N
vg1204930683	A -> G	LOC_Os12g09400.1	downstream_gene_variant ; 631.0bp to feature; MODIFIER	silent_mutation	Average:15.626; most accessible tissue: Callus, score: 20.564	N	N	N	N
vg1204930683	A -> G	LOC_Os12g09420.1	downstream_gene_variant ; 3118.0bp to feature; MODIFIER	silent_mutation	Average:15.626; most accessible tissue: Callus, score: 20.564	N	N	N	N
vg1204930683	A -> G	LOC_Os12g09400-LOC_Os12g09410	intergenic_region ; MODIFIER	silent_mutation	Average:15.626; most accessible tissue: Callus, score: 20.564	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204930683	NA	7.80E-06	mr1156	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204930683	NA	4.48E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204930683	NA	5.51E-07	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204930683	NA	4.88E-06	mr1691_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204930683	NA	3.55E-06	mr1720_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251