Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204671441:

Variant ID: vg1204671441 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4671441
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGGAGAATTTCAAATTTCCAGCAGACGAGAGATGAGTCTATTCCCGAGGCATGGGAACGACTACAGGAGTATATGGCCGCCTGTCCTCATCATGGGAT[G/A]
GACGACTGGCTGATCCTGCAGAACTTTTACACTTGGTTCACTCCTACGTCTCGCGACCACCTGGACACGGTAGCTAGAGGAGCCTTTTTCTCTAAGACGG

Reverse complement sequence

CCGTCTTAGAGAAAAAGGCTCCTCTAGCTACCGTGTCCAGGTGGTCGCGAGACGTAGGAGTGAACCAAGTGTAAAAGTTCTGCAGGATCAGCCAGTCGTC[C/T]
ATCCCATGATGAGGACAGGCGGCCATATACTCCTGTAGTCGTTCCCATGCCTCGGGAATAGACTCATCTCTCGTCTGCTGGAAATTTGAAATTCTCCCAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 7.90% 0.02% 0.00% NA
All Indica  2759 98.10% 1.90% 0.00% 0.00% NA
All Japonica  1512 88.50% 11.40% 0.07% 0.00% NA
Aus  269 45.70% 54.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 5.10% 0.00% 0.00% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 92.10% 7.90% 0.00% 0.00% NA
Japonica Intermediate  241 56.80% 42.70% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204671441 G -> A LOC_Os12g08940.1 downstream_gene_variant ; 2294.0bp to feature; MODIFIER silent_mutation Average:63.346; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1204671441 G -> A LOC_Os12g08950.1 downstream_gene_variant ; 149.0bp to feature; MODIFIER silent_mutation Average:63.346; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N
vg1204671441 G -> A LOC_Os12g08950-LOC_Os12g08960 intergenic_region ; MODIFIER silent_mutation Average:63.346; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204671441 NA 1.36E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 2.31E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 9.20E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 5.29E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 3.70E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 2.04E-08 NA mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 6.69E-06 1.12E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 8.61E-08 NA mr1691 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 1.36E-08 1.18E-11 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 4.65E-10 NA mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 5.28E-10 1.43E-16 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 1.23E-10 9.32E-18 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 1.03E-06 2.43E-09 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 2.64E-07 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 2.76E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 5.53E-07 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 7.38E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 3.22E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 6.23E-06 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 7.05E-08 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 1.60E-08 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 4.84E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 9.68E-08 1.70E-07 mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 7.98E-06 4.65E-09 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 1.02E-06 NA mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204671441 NA 1.80E-07 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251