Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204504508:

Variant ID: vg1204504508 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4504508
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTCCTTATTTAAAAACAGTTAGCTATTACTTCGACACTAGAATTTCATTGAGTTGCCTTGGAGTAAAAATTCTGGGAATATTACCATGAGTAGAGCAA[G/T]
TCTTGGTAATCAGTCATTCAGTTGTGCGATGTTTGATTATGGCAAAATTGCAAAGGAGGGTCATAATTGTTATGATTTTATTCTAGTTTTTGACCAATTT

Reverse complement sequence

AAATTGGTCAAAAACTAGAATAAAATCATAACAATTATGACCCTCCTTTGCAATTTTGCCATAATCAAACATCGCACAACTGAATGACTGATTACCAAGA[C/A]
TTGCTCTACTCATGGTAATATTCCCAGAATTTTTACTCCAAGGCAACTCAATGAAATTCTAGTGTCGAAGTAATAGCTAACTGTTTTTAAATAAGGAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 7.30% 0.08% 0.00% NA
All Indica  2759 97.10% 2.90% 0.04% 0.00% NA
All Japonica  1512 86.00% 13.80% 0.13% 0.00% NA
Aus  269 79.60% 20.10% 0.37% 0.00% NA
Indica I  595 91.40% 8.40% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 95.40% 4.40% 0.13% 0.00% NA
Tropical Japonica  504 86.90% 13.10% 0.00% 0.00% NA
Japonica Intermediate  241 54.40% 45.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204504508 G -> T LOC_Os12g08770.1 upstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:69.147; most accessible tissue: Minghui63 flag leaf, score: 98.571 N N N N
vg1204504508 G -> T LOC_Os12g08760.1 downstream_gene_variant ; 518.0bp to feature; MODIFIER silent_mutation Average:69.147; most accessible tissue: Minghui63 flag leaf, score: 98.571 N N N N
vg1204504508 G -> T LOC_Os12g08760-LOC_Os12g08770 intergenic_region ; MODIFIER silent_mutation Average:69.147; most accessible tissue: Minghui63 flag leaf, score: 98.571 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1204504508 G T -0.03 -0.02 -0.02 -0.01 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204504508 NA 6.63E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 3.67E-06 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 7.09E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 5.91E-06 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 6.66E-06 4.25E-09 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 8.40E-12 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 1.07E-06 mr1720 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 1.27E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 2.57E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 7.75E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 6.10E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 4.40E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 4.67E-06 4.60E-08 mr1508_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 2.15E-06 mr1594_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 1.83E-07 mr1691_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204504508 NA 2.36E-06 mr1720_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251