Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204491827:

Variant ID: vg1204491827 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 4491827
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


ACATCGATCTGCATCTGCCAATTGCGTTCGATTGAGCAAGATTGCTTATCTACCACTACTACTGCAAATATAGTATATAATGCAATTATTGTCAGTGAGA[G/A]
TTGAATATATATTGCCACTCAAGATGAGGTTGACACAAACTCTGCATGCATATCTGATAAAGCGAAATAGTACTCCCTCTGTTTTCGGATAACTGATATT

Reverse complement sequence

AATATCAGTTATCCGAAAACAGAGGGAGTACTATTTCGCTTTATCAGATATGCATGCAGAGTTTGTGTCAACCTCATCTTGAGTGGCAATATATATTCAA[C/T]
TCTCACTGACAATAATTGCATTATATACTATATTTGCAGTAGTAGTGGTAGATAAGCAATCTTGCTCAATCGAACGCAATTGGCAGATGCAGATCGATGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 39.80% 8.29% 0.08% NA
All Indica  2759 87.20% 8.80% 3.95% 0.00% NA
All Japonica  1512 1.10% 89.40% 9.52% 0.00% NA
Aus  269 0.70% 48.30% 49.44% 1.49% NA
Indica I  595 83.50% 7.70% 8.74% 0.00% NA
Indica II  465 95.30% 3.70% 1.08% 0.00% NA
Indica III  913 89.40% 8.80% 1.86% 0.00% NA
Indica Intermediate  786 82.70% 12.80% 4.45% 0.00% NA
Temperate Japonica  767 1.00% 95.60% 3.39% 0.00% NA
Tropical Japonica  504 1.00% 90.10% 8.93% 0.00% NA
Japonica Intermediate  241 1.20% 68.50% 30.29% 0.00% NA
VI/Aromatic  96 1.00% 97.90% 1.04% 0.00% NA
Intermediate  90 26.70% 67.80% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1204491827 G -> DEL N N silent_mutation Average:67.562; most accessible tissue: Zhenshan97 flower, score: 92.109 N N N N
vg1204491827 G -> A LOC_Os12g08750-LOC_Os12g08760 intergenic_region ; MODIFIER silent_mutation Average:67.562; most accessible tissue: Zhenshan97 flower, score: 92.109 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1204491827 G A -0.22 -0.06 -0.02 -0.02 -0.05 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1204491827 NA 1.56E-28 mr1037 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 3.12E-48 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 1.58E-35 mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 2.46E-28 mr1221 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 8.44E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 1.57E-52 mr1458 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 3.75E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 1.21E-50 mr1798 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 5.48E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 6.34E-33 mr1037_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 9.56E-19 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 6.30E-61 mr1458_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 6.03E-10 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1204491827 NA 4.42E-73 mr1798_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251