Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1204078883:

Variant ID: vg1204078883 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 4078883
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCACATGCACGTACACGTACGGATGGACCGATATAGAACGTGGTGCTTTCTAAATATAAATCTATCTATTTGGTATTTTTTAGTTAGATCTAATGGTTA[G/T]
AAAATATGGGTCCCCCAGATTAAATGAAAATCAATGGTTAGATATTTTATTTTTTTCCCAGAATTTCCCTAATTTATTAGAGCGCCACTTGGCGGCCTAG

Reverse complement sequence

CTAGGCCGCCAAGTGGCGCTCTAATAAATTAGGGAAATTCTGGGAAAAAAATAAAATATCTAACCATTGATTTTCATTTAATCTGGGGGACCCATATTTT[C/A]
TAACCATTAGATCTAACTAAAAAATACCAAATAGATAGATTTATATTTAGAAAGCACCACGTTCTATATCGGTCCATCCGTACGTGTACGTGCATGTGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	3.20%	13.73%	15.98%	NA
All Indica	2759	51.50%	5.30%	21.02%	22.15%	NA
All Japonica	1512	89.20%	0.10%	3.37%	7.34%	NA
Aus	269	86.60%	1.10%	4.09%	8.18%	NA
Indica I	595	26.70%	9.90%	23.53%	39.83%	NA
Indica II	465	48.20%	2.80%	20.22%	28.82%	NA
Indica III	913	69.10%	3.80%	18.18%	8.87%	NA
Indica Intermediate	786	51.90%	5.00%	22.90%	20.23%	NA
Temperate Japonica	767	95.60%	0.00%	1.83%	2.61%	NA
Tropical Japonica	504	86.30%	0.20%	2.38%	11.11%	NA
Japonica Intermediate	241	75.10%	0.00%	10.37%	14.52%	NA
VI/Aromatic	96	96.90%	0.00%	1.04%	2.08%	NA
Intermediate	90	82.20%	1.10%	6.67%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1204078883	G -> DEL	N	N	silent_mutation	Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1204078883	G -> T	LOC_Os12g08020.1	upstream_gene_variant ; 3360.0bp to feature; MODIFIER	silent_mutation	Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1204078883	G -> T	LOC_Os12g08030.1	upstream_gene_variant ; 3335.0bp to feature; MODIFIER	silent_mutation	Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1204078883	G -> T	LOC_Os12g08025.1	downstream_gene_variant ; 385.0bp to feature; MODIFIER	silent_mutation	Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1204078883	G -> T	LOC_Os12g08020-LOC_Os12g08025	intergenic_region ; MODIFIER	silent_mutation	Average:12.482; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1204078883	4.80E-06	NA	mr1645	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251