Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1203260505:

Variant ID: vg1203260505 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 3260505
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGAGTCTACTCTTTTCGCCCATTTGTTCGTGTCTTAACCTTGCGCTTTTCCATTTACCTTTCTAGTGCTGATTTTAGCAGGGTATTCGCTATCATGCCT[A/G]
GAAATTCACAAACCAGAATTTCTAAGCTGAATGTGCATTAAACCCCTGTCCAGGACCAGCCAGGGTACACAAATGACAATTGTTGTCATACAGACCCACG

Reverse complement sequence

CGTGGGTCTGTATGACAACAATTGTCATTTGTGTACCCTGGCTGGTCCTGGACAGGGGTTTAATGCACATTCAGCTTAGAAATTCTGGTTTGTGAATTTC[T/C]
AGGCATGATAGCGAATACCCTGCTAAAATCAGCACTAGAAAGGTAAATGGAAAAGCGCAAGGTTAAGACACGAACAAATGGGCGAAAAGAGTAGACTCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	35.20%	0.04%	0.08%	NA
All Indica	2759	95.60%	4.20%	0.07%	0.14%	NA
All Japonica	1512	5.40%	94.60%	0.00%	0.00%	NA
Aus	269	95.20%	4.80%	0.00%	0.00%	NA
Indica I	595	98.00%	1.80%	0.00%	0.17%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	92.80%	7.00%	0.11%	0.11%	NA
Indica Intermediate	786	95.30%	4.30%	0.13%	0.25%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	12.50%	87.50%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	41.70%	58.30%	0.00%	0.00%	NA
Intermediate	90	45.60%	54.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1203260505	A -> DEL	N	N	silent_mutation	Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1203260505	A -> G	LOC_Os12g06680.1	upstream_gene_variant ; 4435.0bp to feature; MODIFIER	silent_mutation	Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1203260505	A -> G	LOC_Os12g06700.1	upstream_gene_variant ; 1592.0bp to feature; MODIFIER	silent_mutation	Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1203260505	A -> G	LOC_Os12g06710.1	downstream_gene_variant ; 4336.0bp to feature; MODIFIER	silent_mutation	Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N
vg1203260505	A -> G	LOC_Os12g06690.1	intron_variant ; MODIFIER	silent_mutation	Average:43.22; most accessible tissue: Zhenshan97 flag leaf, score: 57.42	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1203260505	NA	1.85E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505	4.21E-06	NA	mr1011	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505	NA	7.89E-35	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505	NA	7.02E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505	NA	7.02E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1203260505	NA	9.45E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251