Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202674747:

Variant ID: vg1202674747 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2674747
Reference Allele: G	Alternative Allele: T,A,C
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.62, G: 0.37, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CGCTGGTCCTCGAGCTAGTACGTAGCAATCCCTCGCACCACAACCTCAAATGGTCGAGGTACGACTACAGCAATAACGCAGCGGTCCTCGCACCACGACT[G/T,A,C]
CAAATGATCGAGAGACACCTACTCACTGGTTCTCAACCAGTCAATCGTAGTGATCTCTCGTACATTTACTTCTAGTGGTTGAGTTACGTCTACTACCTGG

Reverse complement sequence

CCAGGTAGTAGACGTAACTCAACCACTAGAAGTAAATGTACGAGAGATCACTACGATTGACTGGTTGAGAACCAGTGAGTAGGTGTCTCTCGATCATTTG[C/A,T,G]
AGTCGTGGTGCGAGGACCGCTGCGTTATTGCTGTAGTCGTACCTCGACCATTTGAGGTTGTGGTGCGAGGGATTGCTACGTACTAGCTCGAGGACCAGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	9.00%	0.02%	0.00%	C: 0.02%
All Indica	2759	91.20%	8.70%	0.04%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.00%	0.00%	C: 0.07%
Aus	269	34.60%	65.40%	0.00%	0.00%	NA
Indica I	595	97.10%	2.90%	0.00%	0.00%	NA
Indica II	465	85.60%	14.40%	0.00%	0.00%	NA
Indica III	913	90.50%	9.50%	0.00%	0.00%	NA
Indica Intermediate	786	91.00%	8.90%	0.13%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.00%	C: 0.20%
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202674747	G -> C	LOC_Os12g05790.1	upstream_gene_variant ; 4827.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> C	LOC_Os12g05810.1	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> C	LOC_Os12g05810.3	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> C	LOC_Os12g05810.2	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> C	LOC_Os12g05790-LOC_Os12g05810	intergenic_region ; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> A	LOC_Os12g05790.1	upstream_gene_variant ; 4827.0bp to feature; MODIFIER	N	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> A	LOC_Os12g05810.1	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	N	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> A	LOC_Os12g05810.3	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	N	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> A	LOC_Os12g05810.2	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	N	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> A	LOC_Os12g05790-LOC_Os12g05810	intergenic_region ; MODIFIER	N	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> T	LOC_Os12g05790.1	upstream_gene_variant ; 4827.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> T	LOC_Os12g05810.1	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> T	LOC_Os12g05810.3	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> T	LOC_Os12g05810.2	upstream_gene_variant ; 3317.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N
vg1202674747	G -> T	LOC_Os12g05790-LOC_Os12g05810	intergenic_region ; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Zhenshan97 panicle, score: 67.02	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202674747	1.74E-06	3.07E-06	mr1115	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202674747	NA	2.01E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202674747	NA	1.86E-06	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202674747	NA	2.07E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202674747	NA	2.64E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202674747	NA	9.15E-06	mr1988	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251