Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202542327:

Variant ID: vg1202542327 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2542327
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGACATCTTGACTATTGTGCTACTGTTTGTACCTTTAAGGCTTTAAACATGTCATTACCACTCCTGTATGATTTTCCCAGTCCAATTTTTTGAGTTCT[G/A]
TATGATTTTTTTTTTCAACTTTGAATACCCTTTGCTCAAATCCTGGATCCGTTACTATGGGTATCGTCAACATGTTTTGGGCAGGTACTATGACTCCTAA

Reverse complement sequence

TTAGGAGTCATAGTACCTGCCCAAAACATGTTGACGATACCCATAGTAACGGATCCAGGATTTGAGCAAAGGGTATTCAAAGTTGAAAAAAAAAATCATA[C/T]
AGAACTCAAAAAATTGGACTGGGAAAATCATACAGGAGTGGTAATGACATGTTTAAAGCCTTAAAGGTACAAACAGTAGCACAATAGTCAAGATGTCTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	43.30%	0.66%	0.00%	NA
All Indica	2759	92.60%	6.30%	1.09%	0.00%	NA
All Japonica	1512	2.10%	97.90%	0.00%	0.00%	NA
Aus	269	11.20%	88.80%	0.00%	0.00%	NA
Indica I	595	98.50%	0.30%	1.18%	0.00%	NA
Indica II	465	93.10%	6.70%	0.22%	0.00%	NA
Indica III	913	91.10%	7.20%	1.64%	0.00%	NA
Indica Intermediate	786	89.70%	9.40%	0.89%	0.00%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	33.30%	65.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202542327	G -> A	LOC_Os12g05550.1	upstream_gene_variant ; 4001.0bp to feature; MODIFIER	silent_mutation	Average:32.121; most accessible tissue: Callus, score: 45.242	N	N	N	N
vg1202542327	G -> A	LOC_Os12g05540.1	downstream_gene_variant ; 3307.0bp to feature; MODIFIER	silent_mutation	Average:32.121; most accessible tissue: Callus, score: 45.242	N	N	N	N
vg1202542327	G -> A	LOC_Os12g05540-LOC_Os12g05550	intergenic_region ; MODIFIER	silent_mutation	Average:32.121; most accessible tissue: Callus, score: 45.242	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202542327	NA	2.61E-18	mr1131_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327	NA	9.24E-06	mr1131_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327	NA	1.34E-17	mr1199_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327	NA	9.38E-06	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327	NA	5.47E-06	mr1243_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327	NA	1.95E-07	mr1404_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327	NA	4.07E-06	mr1482_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327	NA	9.36E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202542327	NA	2.53E-09	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251