Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202342821:

Variant ID: vg1202342821 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 2342821
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGATTTATTATTAAATATATTTTTATGTAGGCATATAATTTTATATATTTCACAAAAGTTTTTGAATAAGACAAACGGTTAAACATATGCTAAAAAGT[T/C]
AACGGTGTCAAATATTTCGAAACGGAGGGAGTATGTACACTGTACATGCATTACTCTAGCTGCAGAGTGCACATATATGGGACGGTGCTCGAGTGCATGA

Reverse complement sequence

TCATGCACTCGAGCACCGTCCCATATATGTGCACTCTGCAGCTAGAGTAATGCATGTACAGTGTACATACTCCCTCCGTTTCGAAATATTTGACACCGTT[A/G]
ACTTTTTAGCATATGTTTAACCGTTTGTCTTATTCAAAAACTTTTGTGAAATATATAAAATTATATGCCTACATAAAAATATATTTAATAATAAATCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 34.70% 0.85% 4.27% NA
All Indica  2759 88.90% 2.70% 1.38% 7.00% NA
All Japonica  1512 7.00% 92.70% 0.00% 0.33% NA
Aus  269 92.90% 5.60% 0.37% 1.12% NA
Indica I  595 91.10% 1.80% 1.51% 5.55% NA
Indica II  465 85.80% 3.70% 1.72% 8.82% NA
Indica III  913 90.70% 1.80% 0.55% 7.01% NA
Indica Intermediate  786 87.00% 3.90% 2.04% 7.00% NA
Temperate Japonica  767 8.60% 90.90% 0.00% 0.52% NA
Tropical Japonica  504 1.40% 98.40% 0.00% 0.20% NA
Japonica Intermediate  241 13.70% 86.30% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 31.10% 66.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1202342821 T -> C LOC_Os12g05270.1 upstream_gene_variant ; 3622.0bp to feature; MODIFIER silent_mutation Average:69.049; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N
vg1202342821 T -> C LOC_Os12g05260.1 downstream_gene_variant ; 3650.0bp to feature; MODIFIER silent_mutation Average:69.049; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N
vg1202342821 T -> C LOC_Os12g05260-LOC_Os12g05270 intergenic_region ; MODIFIER silent_mutation Average:69.049; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N
vg1202342821 T -> DEL N N silent_mutation Average:69.049; most accessible tissue: Minghui63 panicle, score: 90.624 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1202342821 T C 0.02 -0.02 -0.01 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1202342821 NA 1.31E-08 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 2.68E-33 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 5.13E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 4.48E-29 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 5.72E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 8.82E-17 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 5.39E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 5.86E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 1.74E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 1.08E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 6.63E-11 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 4.50E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 8.41E-08 NA mr1836 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 4.00E-08 1.02E-07 mr1836 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 4.70E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 8.76E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 2.53E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 3.25E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202342821 NA 7.08E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251