Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1202258122:

Variant ID: vg1202258122 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 2258122
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTCGTACCATCACACCCTATATTTAGTATCAGATCCTCTACTAATATGTATCAACCCGGTATCTAGGTATTAGATCCGTTACTCATAGGTATCAAACCC[G/A]
ACCTAGGTATCGAATCCGGTACTTATAGGTATCAGACCCAATACCTAGGTATTAGACTTGGTATTCATAGGTATCATACTCGGTACCTGGGTATCCGACC

Reverse complement sequence

GGTCGGATACCCAGGTACCGAGTATGATACCTATGAATACCAAGTCTAATACCTAGGTATTGGGTCTGATACCTATAAGTACCGGATTCGATACCTAGGT[C/T]
GGGTTTGATACCTATGAGTAACGGATCTAATACCTAGATACCGGGTTGATACATATTAGTAGAGGATCTGATACTAAATATAGGGTGTGATGGTACGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.60%	1.40%	14.64%	47.38%	NA
All Indica	2759	3.50%	2.30%	24.07%	70.13%	NA
All Japonica	1512	97.40%	0.10%	0.33%	2.18%	NA
Aus	269	2.60%	0.00%	6.69%	90.71%	NA
Indica I	595	2.20%	1.00%	13.61%	83.19%	NA
Indica II	465	5.20%	1.50%	24.30%	69.03%	NA
Indica III	913	1.90%	3.60%	30.12%	64.40%	NA
Indica Intermediate	786	5.30%	2.30%	24.81%	67.56%	NA
Temperate Japonica	767	96.00%	0.30%	0.52%	3.26%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	98.80%	0.00%	0.41%	0.83%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	68.90%	1.10%	5.56%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1202258122	G -> DEL	N	N	silent_mutation	Average:14.16; most accessible tissue: Callus, score: 34.693	N	N	N	N
vg1202258122	G -> A	LOC_Os12g05120.1	upstream_gene_variant ; 4047.0bp to feature; MODIFIER	silent_mutation	Average:14.16; most accessible tissue: Callus, score: 34.693	N	N	N	N
vg1202258122	G -> A	LOC_Os12g05120.2	upstream_gene_variant ; 4045.0bp to feature; MODIFIER	silent_mutation	Average:14.16; most accessible tissue: Callus, score: 34.693	N	N	N	N
vg1202258122	G -> A	LOC_Os12g05120-LOC_Os12g05130	intergenic_region ; MODIFIER	silent_mutation	Average:14.16; most accessible tissue: Callus, score: 34.693	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1202258122	NA	1.25E-32	mr1081	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	9.55E-27	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	4.40E-28	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	2.43E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	1.08E-08	mr1776	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	1.19E-07	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	3.48E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	1.48E-14	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	6.04E-07	mr1979	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1202258122	NA	1.33E-26	mr1386_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251