| Variant ID: vg1202159597 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2159597 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 286. )
CCGTTCTTTGATGACACATAGTAAGATGGGCTCCAACAGAATAAGAGAGCACAACGCCAACGGGTGTGCAGTGTCCTGAGAGCAAGTATAATAGAGGGCT[A/G]
TAAGAAGGCTGAATGCTGATGTGGATGAGAGAGGAGAGGAGAGAGATGAGAAGCGAGCTATAAGTTTACAGCCGGCTTAGGCACAAGAACCAATAAAATC
GATTTTATTGGTTCTTGTGCCTAAGCCGGCTGTAAACTTATAGCTCGCTTCTCATCTCTCTCCTCTCCTCTCTCATCCACATCAGCATTCAGCCTTCTTA[T/C]
AGCCCTCTATTATACTTGCTCTCAGGACACTGCACACCCGTTGGCGTTGTGCTCTCTTATTCTGTTGGAGCCCATCTTACTATGTGTCATCAAAGAACGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 7.60% | 0.25% | 0.61% | NA |
| All Indica | 2759 | 94.90% | 4.90% | 0.07% | 0.07% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.00% | 0.07% | NA |
| Aus | 269 | 7.10% | 79.60% | 3.72% | 9.67% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 91.80% | 8.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 93.30% | 6.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202159597 | A -> DEL | N | N | silent_mutation | Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg1202159597 | A -> G | LOC_Os12g04980.1 | upstream_gene_variant ; 1313.0bp to feature; MODIFIER | silent_mutation | Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg1202159597 | A -> G | LOC_Os12g04990.1 | downstream_gene_variant ; 1951.0bp to feature; MODIFIER | silent_mutation | Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg1202159597 | A -> G | LOC_Os12g04990.2 | downstream_gene_variant ; 1951.0bp to feature; MODIFIER | silent_mutation | Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg1202159597 | A -> G | LOC_Os12g04990.3 | downstream_gene_variant ; 1951.0bp to feature; MODIFIER | silent_mutation | Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg1202159597 | A -> G | LOC_Os12g04990.4 | downstream_gene_variant ; 2870.0bp to feature; MODIFIER | silent_mutation | Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| vg1202159597 | A -> G | LOC_Os12g04980-LOC_Os12g04990 | intergenic_region ; MODIFIER | silent_mutation | Average:70.259; most accessible tissue: Zhenshan97 panicle, score: 86.058 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202159597 | NA | 4.09E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 4.87E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 1.12E-23 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 3.43E-32 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 1.35E-31 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 2.18E-28 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 4.36E-15 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 1.23E-16 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 5.07E-06 | mr1153 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202159597 | NA | 4.52E-15 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/