| Variant ID: vg1202046442 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 2046442 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTAAAGTGTATTAGATTGAGAATTTTTCTTGGGATCCCCTTTACATGGCCCTAGGGGTCTATTTATATCCTTGTTACAGGCCCCCCTATTAGGGTTTAG[G/A]
TTTTACAGGGGAATTTACATGGTTGCCCTTGTGAAAGGGACATTTACATGGGTATACAGTGTCATTGGCATACATGGGCCTCTAATGGGCCTGGTTGGCG
CGCCAACCAGGCCCATTAGAGGCCCATGTATGCCAATGACACTGTATACCCATGTAAATGTCCCTTTCACAAGGGCAACCATGTAAATTCCCCTGTAAAA[C/T]
CTAAACCCTAATAGGGGGGCCTGTAACAAGGATATAAATAGACCCCTAGGGCCATGTAAAGGGGATCCCAAGAAAAATTCTCAATCTAATACACTTTACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.80% | 8.80% | 11.45% | 9.97% | NA |
| All Indica | 2759 | 59.00% | 5.80% | 18.70% | 16.46% | NA |
| All Japonica | 1512 | 98.30% | 0.10% | 0.79% | 0.73% | NA |
| Aus | 269 | 7.10% | 91.10% | 0.74% | 1.12% | NA |
| Indica I | 595 | 66.10% | 1.30% | 26.22% | 6.39% | NA |
| Indica II | 465 | 45.20% | 1.50% | 18.06% | 35.27% | NA |
| Indica III | 913 | 64.10% | 8.80% | 11.72% | 15.44% | NA |
| Indica Intermediate | 786 | 56.00% | 8.40% | 21.50% | 14.12% | NA |
| Temperate Japonica | 767 | 97.80% | 0.00% | 1.17% | 1.04% | NA |
| Tropical Japonica | 504 | 98.80% | 0.20% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 78.90% | 6.70% | 12.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1202046442 | G -> DEL | N | N | silent_mutation | Average:33.394; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg1202046442 | G -> A | LOC_Os12g04810.1 | upstream_gene_variant ; 4799.0bp to feature; MODIFIER | silent_mutation | Average:33.394; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg1202046442 | G -> A | LOC_Os12g04790.1 | downstream_gene_variant ; 966.0bp to feature; MODIFIER | silent_mutation | Average:33.394; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg1202046442 | G -> A | LOC_Os12g04800.1 | downstream_gene_variant ; 62.0bp to feature; MODIFIER | silent_mutation | Average:33.394; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| vg1202046442 | G -> A | LOC_Os12g04790-LOC_Os12g04800 | intergenic_region ; MODIFIER | silent_mutation | Average:33.394; most accessible tissue: Minghui63 root, score: 47.894 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1202046442 | NA | 7.53E-06 | mr1046 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | NA | 1.86E-06 | mr1048 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | NA | 4.78E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | NA | 2.29E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | NA | 4.05E-24 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | NA | 1.71E-33 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | NA | 3.15E-27 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | NA | 3.44E-27 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | NA | 2.08E-16 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1202046442 | 3.42E-06 | NA | mr1148 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/