Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1201867679:

Variant ID: vg1201867679 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 1867679
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGGATGGGCTATTTTCGCGTACGGTTGGCTTAAACCGCTCGCACAGGATAATGCGTTTTCCCGTGCGGGCGATAGCCCGGCACCGGTCCCCTAATTTT[C/T,G]
CGTGCGGTTCCACTTATGTACCGTATGGAAACAAAATGGGGCGGCGTCCAGGAAAATGAATCATGTAGTAGTGTAACCTAAATTGTGCTTTAAATTTGAA

Reverse complement sequence

TTCAAATTTAAAGCACAATTTAGGTTACACTACTACATGATTCATTTTCCTGGACGCCGCCCCATTTTGTTTCCATACGGTACATAAGTGGAACCGCACG[G/A,C]
AAAATTAGGGGACCGGTGCCGGGCTATCGCCCGCACGGGAAAACGCATTATCCTGTGCGAGCGGTTTAAGCCAACCGTACGCGAAAATAGCCCATCCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 3.70% 2.09% 0.00% G: 0.02%
All Indica  2759 99.10% 0.10% 0.72% 0.00% G: 0.04%
All Japonica  1512 84.70% 10.10% 5.16% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.70% 0.50% 0.84% 0.00% NA
Indica II  465 99.10% 0.00% 0.86% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.50% 0.00% 1.40% 0.00% G: 0.13%
Temperate Japonica  767 94.70% 1.00% 4.30% 0.00% NA
Tropical Japonica  504 82.90% 12.90% 4.17% 0.00% NA
Japonica Intermediate  241 56.80% 33.20% 9.96% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1201867679 C -> G LOC_Os12g04410.1 upstream_gene_variant ; 1799.0bp to feature; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg1201867679 C -> G LOC_Os12g04390.1 downstream_gene_variant ; 2132.0bp to feature; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg1201867679 C -> G LOC_Os12g04400.1 intron_variant ; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg1201867679 C -> T LOC_Os12g04410.1 upstream_gene_variant ; 1799.0bp to feature; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg1201867679 C -> T LOC_Os12g04390.1 downstream_gene_variant ; 2132.0bp to feature; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N
vg1201867679 C -> T LOC_Os12g04400.1 intron_variant ; MODIFIER silent_mutation Average:77.867; most accessible tissue: Zhenshan97 young leaf, score: 88.387 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1201867679 C G -0.02 -0.02 -0.01 -0.03 -0.02 -0.02
vg1201867679 C T -0.02 -0.02 -0.01 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1201867679 NA 5.28E-06 mr1064 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 9.33E-07 5.59E-08 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 5.00E-08 1.96E-10 mr1114 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 4.71E-07 3.25E-08 mr1116 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 1.36E-06 2.19E-10 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 NA 4.61E-09 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 1.64E-06 1.76E-08 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 6.86E-06 1.63E-07 mr1120 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 2.65E-07 2.82E-10 mr1123 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 NA 4.44E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 5.02E-07 4.12E-10 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 3.34E-06 1.46E-08 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 9.41E-08 1.41E-11 mr1496 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 NA 4.00E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 3.91E-06 2.00E-10 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 3.95E-06 9.88E-08 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 NA 1.34E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 1.15E-06 2.10E-09 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 2.80E-07 1.44E-09 mr1114_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 6.41E-08 1.15E-11 mr1117_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 7.14E-06 6.15E-09 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 5.34E-08 2.61E-11 mr1119_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 2.37E-07 9.38E-10 mr1120_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 7.97E-07 3.10E-09 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 NA 3.54E-09 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 NA 6.58E-09 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 9.25E-08 1.66E-11 mr1240_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 1.11E-07 1.94E-10 mr1242_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 2.14E-07 7.45E-10 mr1247_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 1.63E-08 3.11E-13 mr1496_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1201867679 NA 7.93E-07 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251