Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200964236:

Variant ID: vg1200964236 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 964236
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTATAGGTCAACTTATAAGCCAAAAGGTGTAAGCCTAAACAAACAAGCAGCTTATTTGTTTGGTTTTTTTGAAGCCATAAGCCACTCTAACACTATTA[A/G]
GCCAAATGCTAGGTTGGAGAAGCTTTTTTGGCTTATGTGAGGTTGATGTATGACTCTACCACTAAACTTAGGACATTAAATCCACCGGCTTATAAATCAT

Reverse complement sequence

ATGATTTATAAGCCGGTGGATTTAATGTCCTAAGTTTAGTGGTAGAGTCATACATCAACCTCACATAAGCCAAAAAAGCTTCTCCAACCTAGCATTTGGC[T/C]
TAATAGTGTTAGAGTGGCTTATGGCTTCAAAAAAACCAAACAAATAAGCTGCTTGTTTGTTTAGGCTTACACCTTTTGGCTTATAAGTTGACCTATAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 49.40% 0.30% 0.02% NA
All Indica  2759 73.30% 26.40% 0.36% 0.04% NA
All Japonica  1512 4.00% 96.00% 0.07% 0.00% NA
Aus  269 98.10% 1.50% 0.37% 0.00% NA
Indica I  595 49.10% 50.80% 0.17% 0.00% NA
Indica II  465 91.60% 8.00% 0.43% 0.00% NA
Indica III  913 76.80% 22.90% 0.33% 0.00% NA
Indica Intermediate  786 76.60% 22.80% 0.51% 0.13% NA
Temperate Japonica  767 5.60% 94.40% 0.00% 0.00% NA
Tropical Japonica  504 2.60% 97.20% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 32.20% 65.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200964236 A -> DEL N N silent_mutation Average:90.478; most accessible tissue: Minghui63 root, score: 96.049 N N N N
vg1200964236 A -> G LOC_Os12g02730.1 upstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:90.478; most accessible tissue: Minghui63 root, score: 96.049 N N N N
vg1200964236 A -> G LOC_Os12g02720-LOC_Os12g02730 intergenic_region ; MODIFIER silent_mutation Average:90.478; most accessible tissue: Minghui63 root, score: 96.049 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1200964236 A G 0.0 0.03 0.03 0.03 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200964236 NA 4.60E-07 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 1.96E-12 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 3.51E-06 mr1293 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 1.21E-08 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 4.95E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 3.90E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 5.15E-08 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 8.49E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 1.07E-10 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 6.87E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 3.57E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 2.89E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 1.73E-20 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 1.72E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 8.37E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 6.26E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 1.04E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 2.52E-12 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 3.30E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 8.93E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 8.02E-15 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 4.38E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 2.17E-08 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 5.09E-06 mr1959 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 1.86E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 9.38E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200964236 NA 5.72E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251