Variant ID: vg1200840948 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 840948 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCAAATATTTAAATTATTGCATTAGATGGAGCTCCATCTAAAAAACCAATGTCCGAAGATAAATCTAGACAAGTCATTGCAGAAGTTGATTTTTTTTTT[C/T]
TGGGATGAAGGAGTAGACAGTAGTAGAAGTAATAATATTTGAGAGTATTCCTTCTATAATATTTTTGAATAATTTGAATAGTAGTCGGTTCACTAATTTT
AAAATTAGTGAACCGACTACTATTCAAATTATTCAAAAATATTATAGAAGGAATACTCTCAAATATTATTACTTCTACTACTGTCTACTCCTTCATCCCA[G/A]
AAAAAAAAAATCAACTTCTGCAATGACTTGTCTAGATTTATCTTCGGACATTGGTTTTTTAGATGGAGCTCCATCTAATGCAATAATTTAAATATTTGAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.30% | 1.30% | 0.38% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 94.80% | 4.10% | 1.12% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 91.70% | 6.30% | 2.09% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1200840948 | C -> T | LOC_Os12g02470.1 | upstream_gene_variant ; 2193.0bp to feature; MODIFIER | silent_mutation | Average:55.738; most accessible tissue: Callus, score: 84.701 | N | N | N | N |
vg1200840948 | C -> T | LOC_Os12g02490.1 | downstream_gene_variant ; 3250.0bp to feature; MODIFIER | silent_mutation | Average:55.738; most accessible tissue: Callus, score: 84.701 | N | N | N | N |
vg1200840948 | C -> T | LOC_Os12g02470-LOC_Os12g02490 | intergenic_region ; MODIFIER | silent_mutation | Average:55.738; most accessible tissue: Callus, score: 84.701 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1200840948 | NA | 3.92E-10 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | NA | 5.96E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | 1.74E-07 | 1.74E-07 | mr1409 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | NA | 6.18E-11 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | NA | 2.55E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | NA | 1.53E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | 2.64E-07 | 1.86E-11 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | NA | 2.65E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | NA | 3.82E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | 6.80E-07 | 1.38E-14 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1200840948 | NA | 1.72E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |