Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200800605:

Variant ID: vg1200800605 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 800605
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGGAACAAAGTTAACACGGTATTATGAGTTGAGAGATGGGATATACCTGGTATTTCGGTTCATGACGAATTCCAGACTTGGCAGCAAACTGAGGATCT[A/G]
AAAAGTGAACTTATTCCTTAAAAAAAAGAAAGAAAAGCCCACATGGGCCTCATGTGGTGTGGTTACTACTAGGATGTTGGCCATCACTTGGTTTTGGACC

Reverse complement sequence

GGTCCAAAACCAAGTGATGGCCAACATCCTAGTAGTAACCACACCACATGAGGCCCATGTGGGCTTTTCTTTCTTTTTTTTAAGGAATAAGTTCACTTTT[T/C]
AGATCCTCAGTTTGCTGCCAAGTCTGGAATTCGTCATGAACCGAAATACCAGGTATATCCCATCTCTCAACTCATAATACCGTGTTAACTTTGTTCCTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 49.40% 0.08% 0.19% NA
All Indica  2759 73.10% 26.50% 0.11% 0.33% NA
All Japonica  1512 4.40% 95.60% 0.00% 0.00% NA
Aus  269 97.40% 2.20% 0.37% 0.00% NA
Indica I  595 55.30% 44.50% 0.00% 0.17% NA
Indica II  465 91.80% 8.00% 0.00% 0.22% NA
Indica III  913 66.20% 33.10% 0.22% 0.55% NA
Indica Intermediate  786 83.50% 16.20% 0.13% 0.25% NA
Temperate Japonica  767 6.00% 94.00% 0.00% 0.00% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 32.20% 67.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200800605 A -> DEL N N silent_mutation Average:90.295; most accessible tissue: Minghui63 root, score: 97.562 N N N N
vg1200800605 A -> G LOC_Os12g02410.1 upstream_gene_variant ; 1064.0bp to feature; MODIFIER silent_mutation Average:90.295; most accessible tissue: Minghui63 root, score: 97.562 N N N N
vg1200800605 A -> G LOC_Os12g02420.1 downstream_gene_variant ; 1884.0bp to feature; MODIFIER silent_mutation Average:90.295; most accessible tissue: Minghui63 root, score: 97.562 N N N N
vg1200800605 A -> G LOC_Os12g02420.2 downstream_gene_variant ; 1884.0bp to feature; MODIFIER silent_mutation Average:90.295; most accessible tissue: Minghui63 root, score: 97.562 N N N N
vg1200800605 A -> G LOC_Os12g02400-LOC_Os12g02410 intergenic_region ; MODIFIER silent_mutation Average:90.295; most accessible tissue: Minghui63 root, score: 97.562 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1200800605 A G 0.03 0.01 0.02 0.02 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200800605 NA 7.83E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 3.20E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 7.38E-07 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 2.28E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 3.03E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 9.39E-08 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 4.09E-09 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 4.05E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 7.94E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 5.77E-08 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 3.43E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 8.68E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 1.98E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 1.50E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 1.69E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 2.10E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 3.69E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 2.76E-14 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 7.34E-14 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 1.16E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 9.54E-16 mr1683 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 1.08E-10 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 1.21E-20 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 8.37E-10 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 4.75E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 4.20E-08 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 2.48E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 2.85E-23 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 5.62E-23 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 5.67E-12 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 9.87E-08 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 8.79E-17 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 1.11E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 3.44E-07 mr1979 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200800605 NA 2.94E-07 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251