| Variant ID: vg1200618450 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 618450 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 304. )
AAATACTACTATTGTGTGACGAGATGGTGAGGCAGCGGCTTCAGCGTTGAGTTGGCGTTGAGAAGTAAGAAAAGTAGTGGATGCTCTAAAAAGACAGTGA[G/A]
AGAAAACAATCATGTTATGATAGTGGATCCAATATAATAGCAAAATATGTTGAAGGCGGAGGAGGCCAATAACACGAGAGAAATGAAGTAGAGATGAAAA
TTTTCATCTCTACTTCATTTCTCTCGTGTTATTGGCCTCCTCCGCCTTCAACATATTTTGCTATTATATTGGATCCACTATCATAACATGATTGTTTTCT[C/T]
TCACTGTCTTTTTAGAGCATCCACTACTTTTCTTACTTCTCAACGCCAACTCAACGCTGAAGCCGCTGCCTCACCATCTCGTCACACAATAGTAGTATTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.50% | 27.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 81.30% | 18.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 59.70% | 40.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 75.80% | 23.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 57.00% | 42.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.00% | 10.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.10% | 88.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 49.00% | 50.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 84.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 35.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1200618450 | G -> A | LOC_Os12g02070.1 | upstream_gene_variant ; 813.0bp to feature; MODIFIER | silent_mutation | Average:54.53; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1200618450 | G -> A | LOC_Os12g02060.1 | downstream_gene_variant ; 2605.0bp to feature; MODIFIER | silent_mutation | Average:54.53; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| vg1200618450 | G -> A | LOC_Os12g02070-LOC_Os12g02080 | intergenic_region ; MODIFIER | silent_mutation | Average:54.53; most accessible tissue: Zhenshan97 panicle, score: 80.486 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1200618450 | NA | 3.56E-09 | mr1064 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200618450 | NA | 9.32E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200618450 | NA | 7.17E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200618450 | NA | 1.79E-08 | mr1534 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200618450 | NA | 9.30E-07 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200618450 | NA | 2.19E-07 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200618450 | NA | 3.81E-15 | mr1115_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200618450 | NA | 4.64E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1200618450 | NA | 5.38E-11 | mr1789_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |