Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200292611:

Variant ID: vg1200292611 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 292611
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

AAATCATAAAGTAATTTAGCATAAAATGGAAGTAAATTGTTACAATATTAAAAGCAAATTCGTCGTAGAGAGAAAAATATGGTCTATCTAAAAATTAAAT[T/A]
AAAGTCCACAAATTATAGAATTGACTAAAAACAATAATAAAAATAATCAACTTAGAGCATTATGAATGTATAAGAAGTAATTTAATCAAATCGAAAAGTA

Reverse complement sequence

TACTTTTCGATTTGATTAAATTACTTCTTATACATTCATAATGCTCTAAGTTGATTATTTTTATTATTGTTTTTAGTCAATTCTATAATTTGTGGACTTT[A/T]
ATTTAATTTTTAGATAGACCATATTTTTCTCTCTACGACGAATTTGCTTTTAATATTGTAACAATTTACTTCCATTTTATGCTAAATTACTTTATGATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.70%	16.70%	0.34%	0.32%	NA
All Indica	2759	70.70%	28.20%	0.54%	0.54%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	50.30%	49.10%	0.67%	0.00%	NA
Indica II	465	93.10%	6.20%	0.22%	0.43%	NA
Indica III	913	69.30%	29.50%	0.33%	0.88%	NA
Indica Intermediate	786	74.60%	23.90%	0.89%	0.64%	NA
Temperate Japonica	767	99.30%	0.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1200292611	T -> DEL	N	N	silent_mutation	Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N
vg1200292611	T -> A	LOC_Os12g01480.1	upstream_gene_variant ; 1098.0bp to feature; MODIFIER	silent_mutation	Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N
vg1200292611	T -> A	LOC_Os12g01470.1	downstream_gene_variant ; 4604.0bp to feature; MODIFIER	silent_mutation	Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N
vg1200292611	T -> A	LOC_Os12g01490.1	downstream_gene_variant ; 4005.0bp to feature; MODIFIER	silent_mutation	Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N
vg1200292611	T -> A	LOC_Os12g01480-LOC_Os12g01490	intergenic_region ; MODIFIER	silent_mutation	Average:18.109; most accessible tissue: Zhenshan97 young leaf, score: 28.885	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1200292611	NA	5.52E-07	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200292611	NA	2.75E-07	mr1729	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251