Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128817624:

Variant ID: vg1128817624 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28817624
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTACCAATAGCTAGCACATTCAACAATATTTAGGAGAAAAACCTTTTCACTTTAATTACAGGTGTAACTAGAGTGTAGATTTGTTTTGAACGTAAAAC[C/T]
CGCACTTGCCCAGTGGTGGAGAGGGCTCGCCAAAGAGGCAGAGCTTGTGCAATTGAATCCCGCGCTGTCGATTTTATTCCCAATCTCCACCCGCATGAAT

Reverse complement sequence

ATTCATGCGGGTGGAGATTGGGAATAAAATCGACAGCGCGGGATTCAATTGCACAAGCTCTGCCTCTTTGGCGAGCCCTCTCCACCACTGGGCAAGTGCG[G/A]
GTTTTACGTTCAAAACAAATCTACACTCTAGTTACACCTGTAATTAAAGTGAAAAGGTTTTTCTCCTAAATATTGTTGAATGTGCTAGCTATTGGTAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.40%	22.20%	7.93%	2.50%	NA
All Indica	2759	87.00%	10.20%	1.74%	1.05%	NA
All Japonica	1512	32.90%	42.00%	20.30%	4.76%	NA
Aus	269	77.00%	17.80%	1.49%	3.72%	NA
Indica I	595	96.80%	2.70%	0.34%	0.17%	NA
Indica II	465	95.90%	2.40%	1.72%	0.00%	NA
Indica III	913	76.10%	19.50%	1.75%	2.63%	NA
Indica Intermediate	786	86.90%	9.80%	2.80%	0.51%	NA
Temperate Japonica	767	52.20%	25.80%	18.77%	3.26%	NA
Tropical Japonica	504	11.10%	61.70%	21.23%	5.95%	NA
Japonica Intermediate	241	17.40%	52.30%	23.24%	7.05%	NA
VI/Aromatic	96	15.60%	71.90%	7.29%	5.21%	NA
Intermediate	90	71.10%	16.70%	10.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128817624	C -> T	LOC_Os11g47780.1	upstream_gene_variant ; 1901.0bp to feature; MODIFIER	silent_mutation	Average:52.716; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1128817624	C -> T	LOC_Os11g47790.1	upstream_gene_variant ; 839.0bp to feature; MODIFIER	silent_mutation	Average:52.716; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1128817624	C -> T	LOC_Os11g47800.1	upstream_gene_variant ; 3141.0bp to feature; MODIFIER	silent_mutation	Average:52.716; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1128817624	C -> T	LOC_Os11g47780-LOC_Os11g47790	intergenic_region ; MODIFIER	silent_mutation	Average:52.716; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1128817624	C -> DEL	N	N	silent_mutation	Average:52.716; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128817624	1.43E-07	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	2.52E-06	6.49E-07	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	NA	1.20E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	9.00E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	NA	6.73E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	NA	1.90E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	9.91E-06	3.88E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	7.88E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	NA	2.50E-08	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	6.89E-06	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	NA	8.63E-11	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	4.85E-07	4.85E-07	mr1609_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	NA	3.47E-06	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817624	NA	9.11E-09	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251