Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128779208:

Variant ID: vg1128779208 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28779208
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCTGAGACAGCTGACTTTCGATGGTGTTTTCTCTTAAACCGTCCGGTGGAGTTGTTACTTGGTTTGTCTAGTTTATTATATCAAGTTTGCAACTCGATC[T/C]
AACGGTTGGTTTAAGAGAAATCGTGTTTTTACATAAGCATTGTCGTGTTGTTTTTAGGCTGACAGTCAGACTGCGAGAATACATGCGGTCAGACCGGCTA

Reverse complement sequence

TAGCCGGTCTGACCGCATGTATTCTCGCAGTCTGACTGTCAGCCTAAAAACAACACGACAATGCTTATGTAAAAACACGATTTCTCTTAAACCAACCGTT[A/G]
GATCGAGTTGCAAACTTGATATAATAAACTAGACAAACCAAGTAACAACTCCACCGGACGGTTTAAGAGAAAACACCATCGAAAGTCAGCTGTCTCAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	7.70%	0.47%	8.68%	NA
All Indica	2759	86.30%	0.90%	0.62%	12.18%	NA
All Japonica	1512	81.10%	17.90%	0.20%	0.79%	NA
Aus	269	56.50%	22.30%	0.37%	20.82%	NA
Indica I	595	97.60%	0.70%	0.00%	1.68%	NA
Indica II	465	61.50%	0.40%	2.37%	35.70%	NA
Indica III	913	95.20%	0.40%	0.11%	4.27%	NA
Indica Intermediate	786	82.10%	1.90%	0.64%	15.39%	NA
Temperate Japonica	767	74.40%	24.30%	0.26%	1.04%	NA
Tropical Japonica	504	91.50%	7.90%	0.20%	0.40%	NA
Japonica Intermediate	241	80.50%	18.70%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	10.00%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128779208	T -> DEL	N	N	silent_mutation	Average:41.033; most accessible tissue: Callus, score: 77.587	N	N	N	N
vg1128779208	T -> C	LOC_Os11g47660.1	upstream_gene_variant ; 612.0bp to feature; MODIFIER	silent_mutation	Average:41.033; most accessible tissue: Callus, score: 77.587	N	N	N	N
vg1128779208	T -> C	LOC_Os11g47670.1	upstream_gene_variant ; 1953.0bp to feature; MODIFIER	silent_mutation	Average:41.033; most accessible tissue: Callus, score: 77.587	N	N	N	N
vg1128779208	T -> C	LOC_Os11g47680.1	upstream_gene_variant ; 3950.0bp to feature; MODIFIER	silent_mutation	Average:41.033; most accessible tissue: Callus, score: 77.587	N	N	N	N
vg1128779208	T -> C	LOC_Os11g47690.1	upstream_gene_variant ; 4942.0bp to feature; MODIFIER	silent_mutation	Average:41.033; most accessible tissue: Callus, score: 77.587	N	N	N	N
vg1128779208	T -> C	LOC_Os11g47650.1	downstream_gene_variant ; 1221.0bp to feature; MODIFIER	silent_mutation	Average:41.033; most accessible tissue: Callus, score: 77.587	N	N	N	N
vg1128779208	T -> C	LOC_Os11g47650.2	downstream_gene_variant ; 1221.0bp to feature; MODIFIER	silent_mutation	Average:41.033; most accessible tissue: Callus, score: 77.587	N	N	N	N
vg1128779208	T -> C	LOC_Os11g47650-LOC_Os11g47660	intergenic_region ; MODIFIER	silent_mutation	Average:41.033; most accessible tissue: Callus, score: 77.587	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128779208	4.13E-06	NA	mr1982	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251