Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128669234:

Variant ID: vg1128669234 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28669234
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCTTGAGCCATACACTCTCCCTAGCCCCCAGCCTTGTCGTCGGAGAATCGTTCTCGGATGATAAGGCTCTGAGACCCTTGACCTACCTTAGTTGAAAGA[T/C]
CGCTGACCCTAGCCCCCAGCCGTGAAGTTGGAAAACTCAATTTTCGATTACACGGCTTGGTTAATACGCACGGTGAGAACTCTTGCATGACCAGATCTTA

Reverse complement sequence

TAAGATCTGGTCATGCAAGAGTTCTCACCGTGCGTATTAACCAAGCCGTGTAATCGAAAATTGAGTTTTCCAACTTCACGGCTGGGGGCTAGGGTCAGCG[A/G]
TCTTTCAACTAAGGTAGGTCAAGGGTCTCAGAGCCTTATCATCCGAGAACGATTCTCCGACGACAAGGCTGGGGGCTAGGGAGAGTGTATGGCTCAAGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	1.70%	10.58%	20.82%	NA
All Indica	2759	50.90%	2.60%	14.82%	31.71%	NA
All Japonica	1512	95.40%	0.10%	2.18%	2.31%	NA
Aus	269	55.40%	2.60%	18.96%	23.05%	NA
Indica I	595	71.30%	1.20%	7.39%	20.17%	NA
Indica II	465	37.80%	3.00%	21.08%	38.06%	NA
Indica III	913	45.00%	3.10%	14.24%	37.68%	NA
Indica Intermediate	786	50.00%	2.80%	17.43%	29.77%	NA
Temperate Japonica	767	95.60%	0.30%	3.00%	1.17%	NA
Tropical Japonica	504	96.60%	0.00%	0.60%	2.78%	NA
Japonica Intermediate	241	92.10%	0.00%	2.90%	4.98%	NA
VI/Aromatic	96	94.80%	0.00%	1.04%	4.17%	NA
Intermediate	90	83.30%	1.10%	6.67%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128669234	T -> DEL	N	N	silent_mutation	Average:53.396; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg1128669234	T -> C	LOC_Os11g47448.1	downstream_gene_variant ; 4749.0bp to feature; MODIFIER	silent_mutation	Average:53.396; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg1128669234	T -> C	LOC_Os11g47449.1	downstream_gene_variant ; 426.0bp to feature; MODIFIER	silent_mutation	Average:53.396; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg1128669234	T -> C	LOC_Os11g47451.1	downstream_gene_variant ; 482.0bp to feature; MODIFIER	silent_mutation	Average:53.396; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg1128669234	T -> C	LOC_Os11g47452.1	downstream_gene_variant ; 4576.0bp to feature; MODIFIER	silent_mutation	Average:53.396; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N
vg1128669234	T -> C	LOC_Os11g47449-LOC_Os11g47451	intergenic_region ; MODIFIER	silent_mutation	Average:53.396; most accessible tissue: Minghui63 flag leaf, score: 73.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128669234	2.27E-06	1.15E-07	mr1530	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251