Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128473972:

Variant ID: vg1128473972 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28473972
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAAAACAAAACTGAACACTGCAGTAGAGCAGAGGACCAACAGCAACACAAGAGAAAAGAAGTCATCACATCTACCTGCTACCTAACTGGAGCACAACA[A/G]
GGCTACCAGCAAGCAGGCAGATTGTGCAACTGCCATCTACTCACCGAACACCAAACTCTCCCTCTCGCTTCTCTTGCAAAACAACCTTTCCAGAACCAAA

Reverse complement sequence

TTTGGTTCTGGAAAGGTTGTTTTGCAAGAGAAGCGAGAGGGAGAGTTTGGTGTTCGGTGAGTAGATGGCAGTTGCACAATCTGCCTGCTTGCTGGTAGCC[T/C]
TGTTGTGCTCCAGTTAGGTAGCAGGTAGATGTGATGACTTCTTTTCTCTTGTGTTGCTGTTGGTCCTCTGCTCTACTGCAGTGTTCAGTTTTGTTTTTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.90%	24.40%	2.33%	22.39%	NA
All Indica	2759	54.50%	22.10%	1.05%	22.29%	NA
All Japonica	1512	42.80%	32.20%	4.76%	20.24%	NA
Aus	269	63.60%	15.20%	2.60%	18.59%	NA
Indica I	595	74.50%	2.90%	0.17%	22.52%	NA
Indica II	465	13.30%	64.10%	1.72%	20.86%	NA
Indica III	913	65.50%	8.90%	1.64%	23.99%	NA
Indica Intermediate	786	51.10%	27.20%	0.64%	20.99%	NA
Temperate Japonica	767	41.20%	35.10%	6.52%	17.21%	NA
Tropical Japonica	504	41.50%	29.80%	2.58%	26.19%	NA
Japonica Intermediate	241	50.60%	28.20%	3.73%	17.43%	NA
VI/Aromatic	96	32.30%	2.10%	1.04%	64.58%	NA
Intermediate	90	56.70%	14.40%	1.11%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128473972	A -> DEL	N	N	silent_mutation	Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845	N	N	N	N
vg1128473972	A -> G	LOC_Os11g47320.1	upstream_gene_variant ; 4160.0bp to feature; MODIFIER	silent_mutation	Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845	N	N	N	N
vg1128473972	A -> G	LOC_Os11g47330.1	upstream_gene_variant ; 489.0bp to feature; MODIFIER	silent_mutation	Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845	N	N	N	N
vg1128473972	A -> G	LOC_Os11g47320.2	upstream_gene_variant ; 4160.0bp to feature; MODIFIER	silent_mutation	Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845	N	N	N	N
vg1128473972	A -> G	LOC_Os11g47320-LOC_Os11g47330	intergenic_region ; MODIFIER	silent_mutation	Average:47.275; most accessible tissue: Zhenshan97 panicle, score: 93.845	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1128473972	A	G	0.05	0.09	0.07	0.06	0.06	0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128473972	NA	1.45E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	6.31E-06	mr1165	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	4.83E-07	mr1478	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	9.10E-07	4.81E-07	mr1755	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	3.84E-07	mr1755	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	8.05E-08	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	6.44E-07	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	2.52E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	8.45E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	4.10E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	5.08E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	6.82E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	4.40E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	3.19E-06	mr1931_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128473972	NA	2.59E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251