Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127802594:

Variant ID: vg1127802594 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27802594
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

GTTTAGTAGTTTGAAAAGCGTGCACGTGAAAAACGAGGGAGATGGGTTGGAAACCCATGGGAAAGAACGTCATTGTCCATGACCTATGCTACACATGTCG[C/T]
AAAGCAAATTTAAACAGCTATAACATTTAAATCACAGCGCTAATTTTTTTAATCCGGTATTTTTTTAAATCATCTGTTGATTTGTTGTTAGTTTGCTTCT

Reverse complement sequence

AGAAGCAAACTAACAACAAATCAACAGATGATTTAAAAAAATACCGGATTAAAAAAATTAGCGCTGTGATTTAAATGTTATAGCTGTTTAAATTTGCTTT[G/A]
CGACATGTGTAGCATAGGTCATGGACAATGACGTTCTTTCCCATGGGTTTCCAACCCATCTCCCTCGTTTTTCACGTGCACGCTTTTCAAACTACTAAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.80%	8.50%	3.00%	30.72%	NA
All Indica	2759	59.00%	9.60%	3.81%	27.51%	NA
All Japonica	1512	55.10%	2.60%	2.05%	40.21%	NA
Aus	269	63.90%	17.10%	0.74%	18.22%	NA
Indica I	595	84.70%	1.50%	0.67%	13.11%	NA
Indica II	465	53.50%	21.50%	7.53%	17.42%	NA
Indica III	913	55.60%	5.30%	3.29%	35.82%	NA
Indica Intermediate	786	46.80%	13.90%	4.58%	34.73%	NA
Temperate Japonica	767	59.30%	4.00%	0.78%	35.85%	NA
Tropical Japonica	504	45.60%	1.60%	4.76%	48.02%	NA
Japonica Intermediate	241	61.40%	0.40%	0.41%	37.76%	NA
VI/Aromatic	96	44.80%	44.80%	1.04%	9.38%	NA
Intermediate	90	60.00%	6.70%	3.33%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127802594	C -> T	LOC_Os11g45960.1	upstream_gene_variant ; 4312.0bp to feature; MODIFIER	silent_mutation	Average:32.115; most accessible tissue: Callus, score: 49.23	N	N	N	N
vg1127802594	C -> T	LOC_Os11g45930.1	downstream_gene_variant ; 4773.0bp to feature; MODIFIER	silent_mutation	Average:32.115; most accessible tissue: Callus, score: 49.23	N	N	N	N
vg1127802594	C -> T	LOC_Os11g45940.1	downstream_gene_variant ; 2299.0bp to feature; MODIFIER	silent_mutation	Average:32.115; most accessible tissue: Callus, score: 49.23	N	N	N	N
vg1127802594	C -> T	LOC_Os11g45950.1	downstream_gene_variant ; 1583.0bp to feature; MODIFIER	silent_mutation	Average:32.115; most accessible tissue: Callus, score: 49.23	N	N	N	N
vg1127802594	C -> T	LOC_Os11g45940-LOC_Os11g45950	intergenic_region ; MODIFIER	silent_mutation	Average:32.115; most accessible tissue: Callus, score: 49.23	N	N	N	N
vg1127802594	C -> DEL	N	N	silent_mutation	Average:32.115; most accessible tissue: Callus, score: 49.23	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127802594	3.90E-06	NA	mr1130	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594	2.24E-08	5.90E-09	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594	NA	9.76E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594	1.47E-11	1.01E-10	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594	7.68E-12	2.25E-11	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594	6.63E-12	6.68E-11	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594	3.74E-09	2.33E-08	mr1900_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594	1.52E-08	1.52E-08	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251