Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127802372:

Variant ID: vg1127802372 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27802372
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATATAAGCTGAAACCGAGAGTTGATTATAGAATAATTATTGATGAGTAACCCTACTTGCTGTGTTCTTTTTGAGAGGTTGAGAACCCCTCCCATCCGCAC[G/A]
GAAAACGGAGCGATAGATCAACACGTGATTAATTAAGCATTAGCTATAACAAACTTAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCCTACATAA

Reverse complement sequence

TTATGTAGGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTAAGTTTGTTATAGCTAATGCTTAATTAATCACGTGTTGATCTATCGCTCCGTTTTC[C/T]
GTGCGGATGGGAGGGGTTCTCAACCTCTCAAAAAGAACACAGCAAGTAGGGTTACTCATCAATAATTATTCTATAATCAACTCTCGGTTTCAGCTTATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	4.70%	0.51%	21.88%	NA
All Indica	2759	76.20%	7.60%	0.33%	15.91%	NA
All Japonica	1512	64.60%	0.30%	0.66%	34.46%	NA
Aus	269	80.30%	1.10%	1.12%	17.47%	NA
Indica I	595	88.90%	0.00%	0.00%	11.09%	NA
Indica II	465	65.60%	21.50%	0.22%	12.69%	NA
Indica III	913	80.30%	3.40%	0.55%	15.77%	NA
Indica Intermediate	786	67.90%	10.10%	0.38%	21.63%	NA
Temperate Japonica	767	65.10%	0.00%	0.52%	34.42%	NA
Tropical Japonica	504	64.10%	1.00%	0.60%	34.33%	NA
Japonica Intermediate	241	63.90%	0.00%	1.24%	34.85%	NA
VI/Aromatic	96	89.60%	0.00%	1.04%	9.38%	NA
Intermediate	90	76.70%	2.20%	1.11%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127802372	G -> A	LOC_Os11g45960.1	upstream_gene_variant ; 4534.0bp to feature; MODIFIER	silent_mutation	Average:34.651; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1127802372	G -> A	LOC_Os11g45930.1	downstream_gene_variant ; 4551.0bp to feature; MODIFIER	silent_mutation	Average:34.651; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1127802372	G -> A	LOC_Os11g45940.1	downstream_gene_variant ; 2077.0bp to feature; MODIFIER	silent_mutation	Average:34.651; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1127802372	G -> A	LOC_Os11g45950.1	downstream_gene_variant ; 1805.0bp to feature; MODIFIER	silent_mutation	Average:34.651; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1127802372	G -> A	LOC_Os11g45940-LOC_Os11g45950	intergenic_region ; MODIFIER	silent_mutation	Average:34.651; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1127802372	G -> DEL	N	N	silent_mutation	Average:34.651; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127802372	5.20E-08	1.33E-08	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372	8.01E-06	NA	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372	4.51E-12	3.54E-11	mr1238_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372	9.45E-06	NA	mr1242_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372	1.16E-12	4.45E-12	mr1484_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372	8.05E-06	NA	mr1609_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372	3.46E-12	8.00E-11	mr1841_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372	4.67E-09	1.51E-08	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372	1.78E-09	1.78E-09	mr1945_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251