Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127582186:

Variant ID: vg1127582186 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27582186
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, C: 0.08, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TATATCGTCTTCTATCCTTTTCATGCATCTTGTACCATATAAGCCAATAACAATTTGGTCAGAATCTCTAAACATTGTGTACGTTATTAACCATTAGAGA[T/C]
ACCTATGATATCAATTACTAACAGTAAATTCCTACCAGAAAAGATATTGGCCCCCGTGTCTTTCTGCTTGGGGCAACAATGGTGGTGATTCAGGCTGCCA

Reverse complement sequence

TGGCAGCCTGAATCACCACCATTGTTGCCCCAAGCAGAAAGACACGGGGGCCAATATCTTTTCTGGTAGGAATTTACTGTTAGTAATTGATATCATAGGT[A/G]
TCTCTAATGGTTAATAACGTACACAATGTTTAGAGATTCTGACCAAATTGTTATTGGCTTATATGGTACAAGATGCATGAAAAGGATAGAAGACGATATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.10%	31.90%	0.55%	12.51%	NA
All Indica	2759	50.70%	32.60%	0.80%	15.95%	NA
All Japonica	1512	67.80%	29.80%	0.00%	2.45%	NA
Aus	269	18.60%	37.90%	1.49%	42.01%	NA
Indica I	595	67.20%	8.70%	1.85%	22.18%	NA
Indica II	465	84.70%	9.20%	0.43%	5.59%	NA
Indica III	913	22.10%	60.10%	0.22%	17.52%	NA
Indica Intermediate	786	51.10%	32.40%	0.89%	15.52%	NA
Temperate Japonica	767	86.20%	9.10%	0.00%	4.69%	NA
Tropical Japonica	504	39.70%	60.10%	0.00%	0.20%	NA
Japonica Intermediate	241	68.00%	32.00%	0.00%	0.00%	NA
VI/Aromatic	96	70.80%	29.20%	0.00%	0.00%	NA
Intermediate	90	67.80%	31.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127582186	T -> DEL	N	N	silent_mutation	Average:10.735; most accessible tissue: Callus, score: 54.484	N	N	N	N
vg1127582186	T -> C	LOC_Os11g45560.1	upstream_gene_variant ; 2904.0bp to feature; MODIFIER	silent_mutation	Average:10.735; most accessible tissue: Callus, score: 54.484	N	N	N	N
vg1127582186	T -> C	LOC_Os11g45570.1	downstream_gene_variant ; 32.0bp to feature; MODIFIER	silent_mutation	Average:10.735; most accessible tissue: Callus, score: 54.484	N	N	N	N
vg1127582186	T -> C	LOC_Os11g45580.1	downstream_gene_variant ; 1437.0bp to feature; MODIFIER	silent_mutation	Average:10.735; most accessible tissue: Callus, score: 54.484	N	N	N	N
vg1127582186	T -> C	LOC_Os11g45560-LOC_Os11g45570	intergenic_region ; MODIFIER	silent_mutation	Average:10.735; most accessible tissue: Callus, score: 54.484	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127582186	6.63E-08	NA	mr1133	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186	1.12E-07	5.65E-15	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186	5.26E-06	NA	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186	1.50E-06	1.20E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186	3.37E-07	3.33E-13	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127582186	NA	7.47E-08	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251